Universidad de Granada - Decsai

Loading...
Universidad de Granada

Departamento de Ciencias de la Computacio´n e Inteligencia Artificial

‘‘Reconocimiento de Perfiles de Regulacio´n Gen´etica Mediante Algoritmos Evolutivos Multiobjetivo” Tesis Doctoral Roc´ıo Celeste Romero Zaliz

Granada, Julio 2005

Universidad de Granada

‘‘Reconocimiento de Perfiles de Regulacio´n Gen´etica Mediante Algoritmos Evolutivos Multiobjetivo” MEMORIA QUE PRESENTA Roc´ıo Celeste Romero Zaliz PARA OPTAR POR EL GRADO DE DOCTOR EN ´ INFORMATICA Julio 2005 DIRECTORES ´ Oscar Cord´ on Garc´ıa e Igor Zwir Departamento de Ciencias de la Computaci´on e Inteligencia Artificial

La memoria titulada “Reconocimiento de Perfiles de Regulaci´ on Gen´etica Mediante Algoritmos Evolutivos Multiobjetivo”, que presenta D a . Roc´ıo Celeste Romero Zaliz para optar al grado de doctor, ha sido realizada dentro del programa de doctorado “Dise˜ no, An´ alisis y Aplicaciones de Sistemas Inteligentes” del Departamento de Ciencias de la Computaci´ on e Inteligencia Artificial de ´ la Universidad de Granada bajo la direcci´ on de los doctores D. Oscar Cord´ on Garc´ıa y D. Igor Zwir.

Granada, Julio 2005

El Doctorando

Los Directores

Fdo: Roc´ıo C. Romero Zaliz

´ Fdo: Oscar Cord´ on Garc´ıa e Igor Zwir

Agradecimientos

A´ un no puedo llegar a comprender como he podido conseguir terminar este trabajo de tesis, lo cual parece una haza˜ na sin precedentes. Si hay algo que la facultad me ha ense˜ nado es que todo tiene una justificaci´ on cient´ıfica. As´ı que intentar´e inferir, cient´ıficamente hablando, las razones que me han llevado a esta situaci´ on para por comprenderla mejor: Si bien la biolog´ıa no es una ciencia exacta, la teor´ıa de la evoluci´ on ha sido, de alguna manera, validada cient´ıficamente. Esto me lleva a pensar que, si he logrado terminar esta tesis, es porque hered´e los genes adecuados. ¿Estoy en lo correcto? Pero dice tambi´en la psicolog´ıa, que la educaci´ on y el entorno en donde crece un ni˜ no es determinante para su desarrollo, tanto mental como social. ¿Ser´ a entonces esa la verdadera raz´ on? Por otro lado, se dice que tener buenos ejemplos a seguir gu´ıan mejor a una persona en su vida. ¿Ser´ a esto tambi´en cierto? Pero si seguimos con esta l´ınea de pensamiento podr´ıamos a˜ nadir que estar en buena compa˜ n´ıa ayuda, ¿no lo creen? En resumen, es por todo lo anterior que deduzco que todos son razones v´ alidas y de peso, y es por ello que esta memoria est´ a dedicada a la familia, la biol´ ogica y la cient´ıfica. De la familia biol´ ogica no puedo dejar de nombrar a mis padres que me han ayudado a ser quien soy y a conseguir todos mis objetivos. Por supuesto, a mis hermanitas que me han dado su apoyo y “aguantado” mis diversos estados de a´nimo. Para la familia cient´ıfica deber´ıamos generar un a´rbol geneal´ ogico. Comen´ zando por mis “padres cient´ıficos”, Igor y Oscar, que han puesto mucho de s´ı para que, tanto mi persona como mi trabajo, saliera adelante con ´exito. Siguiendo por un agradecimiento especial a mi “hermana cient´ıfica peque˜ na”, Cristina. A mi “primos y primas cient´ıficos” de Espa˜ na y de Argentina, aquellos en mi misma situaci´ on que han estado ah´ı en las buenas y en las malas, de entre ellos VII

VIII destaco a mis compa˜ neros de la UBA (Rosana y Daniel) y a mis compa˜ neros del Mecenas (Jes´ us, Menchu, a los Carlos y al plantel de la 16). A mis “t´ıos cient´ıficos”: de Argentina no puedo olvidarme de Anita, Juliana, Mar´ıa Elena, Julio, Marisa, Paula e Isabel; de Espa˜ na, a Ra´ ul, MariCarmen, Miguel y Nacho. Y finalmente, a mis “padrinos cient´ıficos”, Paco e Irene, uno de cada hemisferio, cuya directivas siempre estuvieron presentes en cada paso de mi trabajo. Y a todo aquel que por descuido u omisi´ on he olvidado de mencionar que haya aportado su granito de arena en mi vida. A todos, gracias.

´Indice general

Introducci´ on I. Planteamiento . . . . . . . . . . . . . . . . . . . . . . . . . . . . . II. Objetivos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . III. Resumen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 1 3 4

1. Biolog´ıa y bioinform´ atica 1.1. Caracter´ısticas universales de las c´elulas . . . . . . . . . . . 1.2. La evoluci´ on de los seres vivos . . . . . . . . . . . . . . . . . 1.3. Separaci´ on, clonaci´ on y secuenciaci´ on de ADN . . . . . . . 1.4. Biolog´ıa computacional y Bioinform´ atica . . . . . . . . . . . 1.4.1. Objetivos de la Bioinform´ atica . . . . . . . . . . . . 1.4.2. Problemas cl´ asicos de la bioinform´ atica . . . . . . . 1.4.2.1. Reconocimiento de patrones . . . . . . . . 1.4.2.2. El problema de la b´ usqueda de genes . . . 1.4.2.3. El problema del alineamiento de secuencias 1.4.2.4. El problema del rearreglo gen´ omico . . . . 1.4.2.5. El problema del plegado de prote´ınas . . . 1.4.2.6. El problema de la regulaci´ on de genes . . .

. . . . . . . . . . . .

. . . . . . . . . . . .

. . . . . . . . . . . .

7 7 13 16 18 18 20 20 21 21 22 22 22

2. Preliminares 2.1. Modelado de sistemas . . . . . . . . 2.2. L´ ogica difusa . . . . . . . . . . . . . 2.3. Clustering . . . . . . . . . . . . . . . 2.3.1. Clustering conceptual . . . . 2.3.2. Descubrimiento de subgrupos 2.3.3. Estado del Arte . . . . . . . . 2.3.3.1. APRIORI . . . . . . 2.3.3.2. SUBDUE . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

25 25 28 31 34 35 37 37 37

IX

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

´INDICE GENERAL

X

2.3.4. Clustering generalizado . . . . . . . . . . . . . . . . . . . 2.4. Algoritmos evolutivos . . . . . . . . . . . . . . . . . . . . . . . . 2.4.1. Algoritmos gen´eticos . . . . . . . . . . . . . . . . . . . . . 2.4.2. Algoritmo gen´etico b´ asico . . . . . . . . . . . . . . . . . . 2.4.2.1. Representaci´ on de los cromosomas . . . . . . . . 2.4.2.2. Mecanismo de Selecci´ on . . . . . . . . . . . . . . 2.4.2.3. Operadores gen´eticos . . . . . . . . . . . . . . . 2.4.3. Algoritmos gen´eticos para f. multimodales: Nichos . . . . 2.4.4. Elitismo . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4.5. Programaci´ on gen´etica . . . . . . . . . . . . . . . . . . . . 2.5. Problemas MO y AGMO . . . . . . . . . . . . . . . . . . . . . . 2.5.1. Optimizaci´ on multiobjetivo . . . . . . . . . . . . . . . . . 2.5.2. Estado del arte: NSGA-II . . . . . . . . . . . . . . . . . . 2.5.3. Evaluaci´ on de un algoritmo gen´etico multiobjetivo . . . . 2.5.3.1. M´etricas para la Medici´ on de la Calidad de los Paretos . . . . . . . . . . . . . . . . . . . . . . . 2.5.3.2. Calidad de las soluciones obtenidas entre algoritmos . . . . . . . . . . . . . . . . . . . . . . . . 3. Metodolog´ıa 3.1. Problem´ atica . . . . . . . . . . . . . . . . . . . 3.2. Propuesta . . . . . . . . . . . . . . . . . . . . . 3.2.1. Metodolog´ıa general . . . . . . . . . . . 3.3. Construcci´ on de la base de datos estructurada . 3.4. Clustering Conceptual multiobjetivo . . . . . . 3.5. Evaluaci´ on de los clusters generados . . . . . . 3.6. Compactaci´ on de la base de datos . . . . . . . 3.7. Predicci´ on . . . . . . . . . . . . . . . . . . . . . 3.8. Comentarios finales . . . . . . . . . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

4. Aplicaci´ on a organismos procariotas 4.1. Problema biol´ ogico: regulaci´ on gen´etica . . . . . . . . . . . . . . 4.1.1. La fase de transcripci´ on en organismos procariotas . . . . 4.1.2. Diferentes clases de activadores . . . . . . . . . . . . . . . 4.1.3. Promotores de ADN en organismos procariotas . . . . . . 4.2. Construcci´ on de la base de datos estructurada . . . . . . . . . . . 4.2.1. Submotivos del PhoP-box (“Motivo”) . . . . . . . . . . . . 4.2.2. Orientaci´ on y modelado del PhoP-box (“Orientaci´ on”) . . 4.2.3. Sitios de binding de los factores de transcripci´ on (“Interacci´ on”) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.4. Expresi´ on de genes (“Expresi´ on”) . . . . . . . . . . . . . . 4.2.5. Sitio de binding de la ARN polimerasa (“Promotor”) . . . 4.2.5.1. Ajuste de los modelos . . . . . . . . . . . . . . . 4.2.5.2. Experimentos . . . . . . . . . . . . . . . . . . . .

39 40 41 42 43 44 45 46 48 49 51 52 56 59 59 63 65 65 66 67 69 71 78 82 86 88 91 91 92 94 94 97 99 100 102 102 103 106 109

´INDICE GENERAL 4.3. 4.4. 4.5. 4.6. 4.7.

Aplicaci´ on al dominio de regulaci´ on gen´etica en Evaluaci´ on de los clusters . . . . . . . . . . . . Compactaci´ on de la base de datos . . . . . . . Predicci´ on . . . . . . . . . . . . . . . . . . . . . Comentarios finales . . . . . . . . . . . . . . . .

XI procariotas . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . .

. . . . .

. . . . .

112 114 119 122 124

5. Aplicaci´ on a organismos eucariotas 5.1. Introducci´ on al problema biol´ ogico . . . . . . . . 5.1.1. Las diferentes ontolog´ıas . . . . . . . . . . 5.1.2. Estructura de las ontolog´ıas . . . . . . . . 5.1.3. Formato de las anotaciones utilizando GO 5.2. Construcci´ on de la base de datos estructurada . . 5.3. Aplicaci´ on al dominio de ontolog´ıa de genes . . . 5.4. Evaluaci´ on de los clusters generados . . . . . . . 5.5. Compactaci´ on de la base de datos . . . . . . . . 5.6. Predicci´ on . . . . . . . . . . . . . . . . . . . . . . 5.7. Comentarios finales . . . . . . . . . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

. . . . . . . . . .

127 127 131 132 134 136 137 140 145 153 155

Comentarios finales I. Resumen y conclusiones . . . . . . . . . . . . . I.1. Metodolog´ıa . . . . . . . . . . . . . . . . I.2. Dise˜ no de modelos de objetos biol´ ogicos I.3. Aplicaci´ on a organismos procariotas . . I.4. Aplicaci´ on a organismos eucariotas . . . II. L´ıneas de investigaci´ on futuras . . . . . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

157 157 157 159 160 161 161

. . . . . .

A. Tablas y figuras adicionales

163

Glosario

179

XII

´INDICE GENERAL

´Indice de figuras

1.1. 1.2. 1.3. 1.4. 1.5. 1.6. 1.7. 1.8.

Esquema del ADN . . . . Esquema de un nucle´ otido Az´ ucares . . . . . . . . . . Bases nitrogenadas . . . . Emparejamiento de bases Doble h´elice . . . . . . . . Polinucle´ otidos . . . . . . Microarray . . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

8 8 9 10 11 12 13 18

2.1. Diferentes formas de los clusters . . . . . . . . . . . . . . 2.2. Diferencia entre cercan´ıa y cohesi´ on conceptual . . . . . . 2.3. Poblaci´ on . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4. Genotipo vs. Fenotipo . . . . . . . . . . . . . . . . . . . . 2.5. Generaciones . . . . . . . . . . . . . . . . . . . . . . . . . 2.6. Ejemplo de aplicaci´ on del mecanismo de selecci´ on . . . . . 2.7. Ejemplo de un operador de cruce simple de un punto . . . 2.8. x2 + (x + (x − x)) cruzado con 2x2 para producir 2x2 + x 2.9. Ciclo de PG . . . . . . . . . . . . . . . . . . . . . . . . . . 2.10. Dominancia entre soluciones. . . . . . . . . . . . . . . . . 2.11. Diagrama de flujo del algoritmo NSGA . . . . . . . . . . . 2.12. Esquema del algoritmo NSGA-II . . . . . . . . . . . . . . 2.13. Soluciones posibles . . . . . . . . . . . . . . . . . . . . . . 2.14. Soluciones aglutinadas en una zona del Pareto o´ptimo . .

. . . . . . . . . . . . . .

. . . . . . . . . . . . . .

. . . . . . . . . . . . . .

. . . . . . . . . . . . . .

32 35 42 42 43 45 46 49 50 53 57 59 61 62

3.1. 3.2. 3.3. 3.4.

. . . .

. . . .

. . . .

. . . .

68 70 71 72

Esquema general de la metodolog´ıa CC-EMO . . . Ejemplo de instancia del dominio geom´etrico . . . Ejemplo de subestructuras del dominio geom´etrico Algoritmo CC-EMO . . . . . . . . . . . . . . . . . XIII

. . . . . . . .

. . . .

. . . . . . . .

. . . .

. . . . . . . .

. . . .

. . . .

XIV 3.5. 3.6. 3.7. 3.8. 3.9.

Operaci´ on de cruce de un algoritmo de PG Mutaci´ on: borrado de una hoja . . . . . . . Mutaci´ on: modificaci´ on de un nodo . . . . . Mutaci´ on: agregaci´ on una hoja . . . . . . . Ejemplos de cobertura de una subestructura (b,c) . . . . . . . . . . . . . . . . . . . . . . 3.10. Dos soluciones en el conjunto Pareto . . . . 3.11. Frentes de Pareto obtenidos para el dominio 3.12. Boxplots S, M∗2 y M∗3 . . . . . . . . . . . . 3.13. Boxplots C y N D . . . . . . . . . . . . . . . 3.14. Ejemplo de intersecci´ on . . . . . . . . . . . 3.15. Ejemplo de compactaci´ on . . . . . . . . . . 3.16. Ejemplo de predicci´ on . . . . . . . . . . . .

´INDICE DE FIGURAS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) a dos instancias . . . . . . . . . . . . . . . . . . . . . . . . geom´etrico . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

4.1. 4.2. 4.3. 4.4. 4.5.

Proceso de transcripci´ on del ADN a ARN . . . . . . . . . . . . . Representaci´ on de la base de datos . . . . . . . . . . . . . . . . . Representaci´ on gr´ afica de Mα3 . . . . . . . . . . . . . . . . . . . . Modelado de las distancias entre PhoP-box y promotor. . . . . . Frentes de Pareto para el dominio de regulaci´ on gen´etica en procariotas. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.6. Boxplots S, M∗2 y M∗3 . . . . . . . . . . . . . . . . . . . . . . . . 4.7. Boxplots C y N D . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.8. Clusters de expresi´ on para el dominio de regulaci´ on gen´etica en procariotas. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.9. Intersecci´ on de ClustersA y ClustersB . . . . . . . . . . . . . . . 4.10. Descripci´ on de la expresi´ on del cluster 2 de ClustersA . . . . . . 4.11. Descripci´ on del cluster 78 de ClustersB . . . . . . . . . . . . . . . 4.12. Descripci´ on del cluster 26 de ClustersB . . . . . . . . . . . . . . . 4.13. Descripci´ on del cluster 73 de ClustersB . . . . . . . . . . . . . . . 5.1. 5.2. 5.3. 5.4. 5.5. 5.6. 5.7. 5.8.

Expresi´ on de un conjunto de genes en el tiempo . . . . . . . . . . Clusters de los datos de expresi´ on . . . . . . . . . . . . . . . . . . Relaciones entre t´erminos de GO . . . . . . . . . . . . . . . . . . Ejemplo de anotaci´ on de GO . . . . . . . . . . . . . . . . . . . . Ejemplo de la representaci´ on de una instancia . . . . . . . . . . . Ejemplo de subestructuras que cubren una misma instancia . . . Frentes de Pareto para el dominio de ontolog´ıa de genes. . . . . . Espacio de objetivos vs. espacio de variables de cada conjunto Pareto . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.9. Boxplots S, M∗2 y M∗3 . . . . . . . . . . . . . . . . . . . . . . . . 5.10. Boxplots C y N D . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.11. Intersecci´ on de los ClustersA y ClustersB . . . . . . . . . . . . . 5.12. Secci´ on de las jerarqu´ıas de GO. . . . . . . . . . . . . . . . . . . 5.13. Descripci´ on de la expresi´ on del cluster 13 de ClustersA . . . . . .

73 75 75 75 76 77 79 81 83 84 86 87 93 98 105 113 116 116 117 120 121 122 123 123 124 128 129 133 135 136 139 141 142 144 146 147 149 151

´INDICE DE FIGURAS 5.14. Secci´ on de la jerarqu´ıa de GO . . . . . . . . 5.15. Descripci´ on de la expresi´ on del cluster 17 de 5.16. Nueva anotaci´ on . . . . . . . . . . . . . . . 5.17. Expresi´ on del ClusterB #824 . . . . . . . .

XV . . . . . . ClustersA . . . . . . . . . . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

152 154 155 156

A.1. Intersecci´ on completa de ClustersA y ClustersB . . . . . . . . . . 168

XVI

´INDICE DE FIGURAS

´Indice de tablas

3.1. Par´ ametros para dominio geom´etrico . . . . . . . . . . . . . . . . 3.2. Valores de las m´etricas . . . . . . . . . . . . . . . . . . . . . . . . 4.1. 4.2. 4.3. 4.4. 4.5. 4.6. 4.7.

78 80

Motivos del sitio de binding de PhoP. . . . . . . . . . . . . . . . Distribuci´ on nucleot´ıdica de los motivos obtenida de [48]. . . . . Resultados con los modelos difusos originales . . . . . . . . . . . Resultados utilizando los modelos y umbrales ajustados . . . . . Distribuci´ on de nucle´ otidos ajustados para los motivos . . . . . . Par´ ametros para el dominio de regulaci´ on gen´etica en procariotas Resultado de las m´etricas en el dominio de regulaci´ on gen´etica en procariotas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.8. Descripci´ on de la regi´ on regulatoria de pagK . . . . . . . . . . . .

118 124

5.1. 5.2. 5.3. 5.4. 5.5. 5.6.

Par´ ametros para el dominio de ontolog´ıa de genes . . Resultado de las m´etricas en el dominio GO . . . . . Ejemplos de intersecci´ on de clusters . . . . . . . . . Clusters significativos intersecando al ClusterA #13 Clusters significativos intersecando al ClusterA #17 Descripci´ on del gen 212659_s_at. . . . . . . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

141 143 148 149 152 154

A.1. A.2. A.3. A.4. A.5.

BD BD BD BD BD

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

163 164 165 166 167

de de de de de

promotores promotores promotores promotores promotores

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

1

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

101 104 110 111 112 114

2

´INDICE DE TABLAS

Introduccio´n

I.

Planteamiento

Durante las u ´ltimas d´ecadas, se ha estado acumulando conocimiento, proveniente de diferentes a´reas, en repositorios de datos digitales. Al estar almacenada de esta manera, la informaci´ on puede ser estudiada y compartida m´ as f´ acilmente por distintos expertos. A pesar de esto, el aumento constante del tama˜ no de estos repositorios hace casi imposible, para un ser humano, extraer informaci´ on u ´til de los mismos. Por esta raz´ on, se han desarrollado diversas t´ecnicas de miner´ıa de datos para poder revelar informaci´ on oculta en grandes colecciones de datos [45, 49] y as´ı poder ayudar a los usuarios. Estas t´ecnicas funcionan correctamente con representaciones de datos en forma atributo-valor, es decir, datos no estructurados. Sin embargo, muchos proyectos de adquisici´ on de datos actuales acumulan informaci´ on estructurada que describe no s´ olo los objetos de la base de datos, sino tambi´en las relaciones que existen entre ellos. Estos conjuntos de datos son estructurados en el sentido de que los objetos que almacenan est´ an descritos por las relaciones entre las caracter´ısticas y no solamente por las caracter´ısticas en s´ı mismas. Debido a ello, existe la necesidad de crear t´ecnicas que permitan analizar y descubrir conceptos definidos mediante subestructuras en repositorios de datos estructurados. En particular, en el a´rea de la Bioinform´ atica, se utilizan grandes repositorios de datos que contienen informaci´ on de secuencias de ADN o prote´ınas de genomas completos. Por ejemplo, la base de datos GenBank [16] recog´ıa, en 2004, 40.604.319 secuencias biol´ ogicas compuestas por 44.575.745.176 pares de bases. Esto es debido, en gran parte, a los avances en la Biolog´ıa Molecular y al equipamiento disponible para la investigaci´ on en este campo, que ha permitido la r´ apida secuenciaci´ on de grandes porciones de genomas de diversas especies. En la actualidad, varios genomas de bacterias y algunos eucariotas simples ya han sido secuenciados por completo. Esta gran cantidad de informaci´ on necesita 1

2

´INDICE DE TABLAS

de un alto nivel de organizaci´ on, indexado y almacenamiento de las secuencias. Adicionalmente, una gran parte de las bases de datos biol´ ogicas almacenan informaci´ on estructurada. Como ejemplo de este tipo de base de datos, se puede mencionar la base RegulonDB [84], que contiene datos sobre la regulaci´ on transcripcional, organizaci´ on de operones y condiciones de expresi´ on para el genoma Escherichia coli K-12. Otro ejemplo lo constituye la base de datos Gene Ontology [8], que almacena t´erminos asociados a los procesos biol´ ogicos, funciones moleculares y componentes celulares de secuencias biol´ ogicas de forma jer´ arquica. Las t´ecnicas cl´ asicas de aprendizaje no supervisado para la extracci´ on de informaci´ on en bases de datos incluyen a los algoritmos de clustering (agrupamiento) de datos, de las cuales se han desarrollado varias propuestas. Sin embargo, estas t´ecnicas no pueden aplicarse satisfactoriamente a bases de datos estructuradas. Para poder analizar repositorios estructurados, existe una alternativa al clustering tradicional, consistente en realizar descubrimiento de subgrupos mediante t´ecnicas de clustering conceptual. El clustering conceptual busca no s´ olo una clasificaci´ on de los datos provistos, sino tambi´en una descripci´ on simb´ olica de las clases propuestas (clusters). Consiste en un mecanismo de inducci´ on descriptiva que persigue encontrar patrones interesantes en los datos. La principal ventaja del uso de estas t´ecnicas es la capacidad que presentan no s´ olo para reconocer grupos en los datos, sino para describir las propiedades que los agrupan. Sin embargo, tanto las t´ecnicas de clustering tradicional, como los algoritmos de clustering conceptual, presentan algunos problemas: 1. En particular, las t´ecnicas de clustering tradicional subdividen los objetos de la base de datos en grupos completamente disjuntos, lo que no es natural en la mayor´ıa de dominios de datos reales. 2. Consideran a todos los elementos del repositorio igualmente importantes, cuando no suele ser as´ı en la pr´ actica donde no todos tienen el mismo nivel de inter´es. Algunas instancias pueden contener campos con valores desconocidos o estar expuestos a errores en su definici´ on que pueden representar outliers y, por lo tanto, no ser f´ acilmente agrupables con el resto de la base de datos. 3. Se centran en la optimizaci´ on de un u ´nico criterio de preferencia. Com´ unmente, este criterio suele ser la combinaci´ on de dos o m´ as m´etricas que calculan la bondad de una configuraci´ on de clusters. En la mayor´ıa de los casos, estos criterios est´ an contrapuestos. Por ello, la mayor´ıa de las t´ecnicas de clustering actuales se enfocan en encontrar una buena soluci´ on de compromiso, es decir, un conjunto de clusters que sean aceptablemente buenos simult´ aneamente en todos los criterios contemplados mediante la agregaci´ on de los mismos en un u ´nico criterio de preferencia.

II. OBJETIVOS

3

En esta memoria, se propondr´ a una metodolog´ıa que realiza descubrimiento de subgrupos mediante clustering conceptual haciendo uso de algoritmos evolutivos multiobjetivo. Esta propuesta pretende evitar los tres problemas anteriores que afectan a las t´ecnicas cl´ asicas de aprendizaje no supervisado. Para ejemplificar la propuesta, se aplicar´ a la metodolog´ıa a dos problemas de regulaci´ on gen´etica, uno en organismos procariotas y otro en eucariotas. El primer problema es una colaboraci´ on con el laboratorio del Dr. Eduardo A. Groisman en la Universidad de Washington con sede en St. Loius, Estados Unidos. Este proyecto est´ a respaldado por una subvenci´ on del Howard Huges Medical Institute y estudia los mecanismos utilizados por la bacteria Salmonella enterica, los cuales le permiten prosperar en diferentes entornos y causar enfermedad. Esta bacteria infecta a millones de personas en el mundo cada a˜ no, lo cual resulta en 500.000 fallecidos aproximadamente. La comprensi´ on de estos mecanismos podr´ıa derivar en nuevos tratamientos terap´euticos, prevenci´ on y estrategias de diagn´ ostico. Asimismo, la bacteria de Salmonella sirve como sistema modelo de otros pat´ ogenos intracelulares que no son sencillos de estudiar o carecen de modelos efectivos de infecci´ on. El segundo problema constituye un esfuerzo conjunto dentro del programa de investigaci´ on Inflamaci´ on y respuesta del hu´esped a est´ımulos externos (Inflammation and the Host Response to Injury) en el cual participa el Dr. J. Perren Cobb. Este programa est´ a respaldado por el National Institute of General Medical Sciences (NIGMS), una divisi´ on del National Institutes of Health de Estados Unidos y su objetivo es descubrir las razones biol´ ogicas por las cuales diferentes pacientes pueden llegar a tener respuestas muy distintas tras sufrir una herida traum´ atica. Este programa interdisciplinario a gran escala constituye el primer intento por resolver problemas que resulten en peligros para la vida, producidos por quemaduras o inflamaciones seguidas a un trauma importante. Este proyecto reune a instituciones m´edicas e investigadores de las a´reas de cirug´ıa, gen´ omica, prote´ omica, bioestad´ıstica, bioinform´ atica, biolog´ıa computacional y gen´etica, para estudiar la biolog´ıa molecular de las inflamaciones.

II.

Objetivos

Esta memoria tiene como objetivo principal el desarrollo de una metodolog´ıa que permita descubrir aquellos conceptos ocultos en un conjunto de datos estructurados, brindando al usuario no s´ olo de un conjunto de clusters que concentran a instancias de la base de datos que est´en relacionadas entre s´ı, sino tambi´en de una descripci´ on clara que le permita comprender el por qu´e, o en base a qu´e caracter´ısticas, esas instancias se encuentran agrupadas. La raz´ on de ser de esta metodolog´ıa de clustering conceptual basada en algoritmos evolutivos multiobjetivo es la aplicaci´ on al descubrimiento de perfiles de regulaci´ on gen´etica tanto en organismos procariotas como en eucariotas. En concreto, el objetivo propuesto se subdivide en los siguientes sub-objetivos:

´INDICE DE TABLAS

4

Estudiar el problema biol´ ogico de regulaci´ on gen´etica, tanto en organismos procariotas como en eucariotas. Este estudio debe realizarse desde dos puntos de vista, el biol´ ogico y el inform´ atico. Desde el punto de vista biol´ ogico, se ha de comprender el funcionamiento de las redes gen´eticas en ambas clases de organismos. Desde el punto de vista inform´ atico, tendremos que investigar los distintos enfoques existentes en la literatura para el reconocimiento de perfiles de regulaci´ on gen´etica, ponderando tanto sus aciertos como sus problemas en su aplicaci´ on a situaciones reales. Proponer una metodolog´ıa basada en algoritmos evolutivos multiobjetivo para el descubrimiento de subgrupos, mediante clustering conceptual, que permita la extracci´ on de conocimiento oculto en bases de datos estructuradas y que solucione los problemas que afectan a las t´ecnicas cl´ asicas de clustering comentados anteriormente. Dise˜ nar modelos de objetos biol´ ogicos, utilizando para ello los beneficios del modelado mediante t´ecnicas de l´ ogica difusa, aprendizaje autom´ atico y algoritmos evolutivos multiobjetivo. Construir modelos a la vez precisos e interpretables para cada uno de los componentes involucrados en el proceso de regulaci´ on gen´etica, esperando descubrir nuevos datos relevantes que difieran de los consensos cl´ asicos existentes en la literatura. Estos modelos son los que se utilizar´ an luego conjuntamente con la metodolog´ıa propuesta. Aplicar la metodolog´ıa propuesta a organismos procariotas, utilizando para ello la informaci´ on existente en la base de datos RegulonDB [84]. Extraer de este repositorio informaci´ on que relacione diferentes genes y validar este conocimiento con datos obtenidos experimentalmente. Aplicar la metodolog´ıa propuesta a organismos eucariotas, utilizando para ello la informaci´ on contenida en la base de datos HG-U133A v2.0 de R y la base de datos de Gene Ontology [8]. Recuperar, Affymetrix Inc de estos repositorios, informaci´ on sobre un conjunto de genes evaluados en un estudio de la respuesta inflamatoria de seres humanos al aplicarles una endotoxina en forma intravenosa, en comparaci´ on con un grupo de control al cual se le inyecta un placebo [79]. Extraer de los resultados obtenidos, grupos de genes que tengan propiedades similares y validar este conocimiento con los datos experimentales.

III.

Resumen

Para desarrollar los objetivos planteados, la memoria est´ a organizada en cinco cap´ıtulos, una secci´ on de comentarios finales y un ap´endice. La estructura de cada una de estas partes se comentar´ a brevemente a continuaci´ on.

III. RESUMEN

5

En el Cap´ıtulo 1, se introduce al lector a los conceptos b´ asicos de biolog´ıa molecular, los cuales ser´ an necesarios para la adecuada comprensi´ on de los cap´ıtulos posteriores. Se comienza con una breve descripci´ on de los componentes principales de los organismos vivientes, siguiendo por los procesos necesarios para el mantenimiento de la vida, y finalizando con una breve rese˜ na acerca de los m´etodos biol´ ogicos para el estudio de secuencias de ADN. Adicionalmente, se introduce la Bioinform´ atica, una disciplina moderna y en pleno apogeo, conjuntamente con los problemas cl´ asicos que ´esta abarca. En el Cap´ıtulo 2, se presentan las diferentes t´ecnicas y m´etodos sobre los cuales se basa la metodolog´ıa principal propuesta en esta memoria. Los temas tratados en este cap´ıtulo son: el modelado o la identificaci´ on de sistemas, la l´ ogica difusa, el clustering (agrupamiento) de conjuntos de datos, en particular el clustering conceptual, y los algoritmos evolutivos, con especial atenci´ on a la programaci´ on gen´etica y a las t´ecnicas de optimizaci´ on multiobjetivo. En el Capitulo 3, se explica en detalle la metodolog´ıa propuesta para poder abordar los objetivos comentados anteriormente. Se comienza mostrando el esquema general, para luego desarrollar cada uno de los pasos que la componen. Para una mayor comprensi´ on de la misma, se acompa˜ na cada etapa con ejemplos realizados sobre un dominio sencillo. En el Cap´ıtulo 4, se aplica la metodolog´ıa propuesta a un problema sobre organismos procariotas, el estudio de la regulaci´ on gen´etica en los organismos de E. coli y Salmonella. En las diferentes secciones que componen este cap´ıtulo, se explica como se ha adaptado la metodolog´ıa general al problema espec´ıfico, destacando especialmente el proceso de construcci´ on y modelado del conjunto de datos utilizado. Finalmente, se validar´ an los resultados obtenidos compar´ andolos con datos experimentales. En el Cap´ıtulo 5, se aplica la metodolog´ıa propuesta a un problema sobre organismos eucariotas, un estudio de la respuesta gen´etica a procesos inflamatorios en seres humanos [79]. En las diferentes secciones que componen este cap´ıtulo, se explica como se ha adaptado la metodolog´ıa general al problema espec´ıfico, desde la construcci´ on de la base de datos hasta el proceso final de predicci´ on sobre nuevos genes. Incluimos luego una secci´ on de “Comentarios Finales”, que resume los resultados obtenidos en esta memoria, presentando algunas conclusiones sobre los mismos. Finalmente, se comentar´ an algunos aspectos sobre trabajos futuros que quedan abiertos en la presente memoria. Por u ´ltimo, incluiremos tambi´en un ap´endice donde se presentaran tablas y figuras adicionales asociadas a las dos aplicaciones de la metodolog´ıa.

6

´INDICE DE TABLAS

Cap´ıtulo

1

Fundamentos ba´sicos de biolog´ıa y bioinforma´tica En la actualidad podemos decir que todos los seres vivos est´ an formados por c´elulas y que estas unidades de materia viva comparten una maquinaria com´ un para sus funciones m´ as b´ asicas. Los seres vivos, aunque infinitamente diversos por fuera, son muy similares por dentro. En este primer cap´ıtulo delinearemos las caracter´ısticas universales de todos los seres vivos, inspeccionando brevemente la diversidad celular, y veremos c´ omo, gracias a un c´ odigo com´ un en el que est´ an escritas las especificaciones de todos los organismos, es posible leer, medir y desentra˜ nar estas especificaciones para alcanzar un conocimiento coherente de todas las formas de vida, de las m´ as peque˜ nas a las m´ as grandes.

1.1.

Caracter´ısticas universales de las c´ elulas

Las c´elulas vivas, como los ordenadores, contienen informaci´ on, y se estima que llevan evolucionando y diversific´ andose desde hace m´ as de tres mil millones y medio de a˜ nos. Todas las c´elulas vivas, sin ninguna excepci´ on conocida, guardan su informaci´ on hereditaria en forma de mol´eculas de ADN (´ acido desoxirribonucleico) de doble cadena –dos largos pol´ımeros paralelos no ramificados formados por cuatro tipos de mon´ omeros1 –. Estos mon´ omeros est´ an unidos entre s´ı formando una larga secuencia lineal que codifica la informaci´ on gen´etica de la c´elula, de la misma manera que la secuencia de unos y ceros codifica la informaci´ on en un ordenador [17, 5]. 1 El

material esencia o unidad con la cual se construye un pol´ımero.

7

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

8

Az´ ucar

Fosfato

Figura 1.1: Esquema del ADN

Base Nitrogenada

Fosfato

Pentosa

Figura 1.2: Esquema de un nucle´ otido

Para comprender los mecanismos biol´ ogicos, hemos primero de conocer la estructura de la mol´ecula de ADN de doble cadena (ver Figura 1.1). Cada mon´ omero de una de las cadenas sencillas del ADN –denominado nucle´ otido (ver Figura 1.2)– tiene dos partes: un az´ ucar (la desoxirribosa, ver Figura 1.3) con un grupo fosfato unido y una base que puede ser adenina (A), guanina (G), citosina (C) o timina (T) (ver Figura 1.4). Cada az´ ucar est´ a unido al siguiente az´ ucar de la cadena por el grupo fosfato mediante un enlace fosfodi´ester, formando un pol´ımero cuyo eje central est´ a compuesto por los az´ ucares fosfato y del cual sobresalen las bases. El pol´ımero de ADN puede crecer por la uni´ on de mon´ omeros a uno de sus extremos. En el caso de una cadena sencilla de ADN, los mon´ omeros pueden incorporarse al pol´ımero de forma aleatoria, sin un orden preestablecido, ya que todos los nucle´ otidos pueden unirse entre s´ı del mismo modo en el sentido del crecimiento del pol´ımero de ADN. Por el contrario, en la c´elula viva existe una limitaci´ on, ya que el ADN no se sintetiza como una cadena libre aislada sino sobre un patr´ on o molde de ADN de otra cadena preexistente. Las bases contenidas en la cadena patr´ on se unen a las bases de la nueva cadena siguiendo una estricta norma de complementariedad: A se une a T, y C se une a G (ver Figura 1.5). Este emparejamiento une los nuevos mon´ omeros de la cadena y adem´ as controla la selecci´ on del mon´ omero que se a˜ nade a la mis-

´ 1.1. CARACTER´ISTICAS UNIVERSALES DE LAS CELULAS

(a) Ribosa

9

(b) Desoxirribosa

Figura 1.3: Az´ ucares ma. De esta forma, una estructura de doble cadena consiste en dos secuencias complementarias de A, C, G y T. El orden de la secuencia es muy importante, ya que en ´el reside la informaci´ on contenida en el a´cido nucleico. La orientaci´ on viene dada en el sentido 5’-3’ o 3’-5’, donde el 5’ representa el extremo terminal del fosfato y el 3’ el extremo final del a´tomo de carbono de la desoxirribosa. Adem´ as, las dos cadenas de nucle´ otidos se enrollan una sobre la otra generando una doble h´elice (ver Figura 1.6). Los enlaces establecidos entre las bases son d´ebiles si se comparan con las uniones az´ ucar-fosfato del resto del esqueleto. Esta debilidad permite separar las dos cadenas de ADN sin forzar la rotura de su esqueleto. Cada una de las cadenas puede comportarse como un molde o patr´ on en la s´ıntesis de una nueva mol´ecula de ADN. Para llevar a cabo satisfactoriamente la funci´ on de almac´en de la informaci´ on, el ADN tiene que hacer algo m´ as que duplicarse antes de cada divisi´ on celular. Ha de expresar la informaci´ on que contiene, utiliz´ andola para dirigir la s´ıntesis de otras mol´eculas de la c´elula. El mecanismo responsable de este proceso es el mismo en todos los organismos vivos y se inicia con la s´ıntesis secuencial de dos tipos de mol´eculas: el a´cido ribonucleico (ARN) y las prote´ınas. El proceso comienza con la polimerizaci´ on sobre un patr´ on, denominada transcripci´ on, proceso en el que diferentes segmentos de la secuencia de ADN se utilizan como molde para la s´ıntesis de mol´eculas cortas de un pol´ımero muy relacionado con el ADN: el ´ acido ribonucleico o ARN (ver Figura 1.7). Despu´es de un proceso complejo denominado traducci´ on, muchas de estas mol´eculas de ARN se utilizan para dirigir la s´ıntesis de pol´ımeros de una clase qu´ımica radicalmente diferente: las prote´ınas. En el ARN, el esqueleto del pol´ımero est´ a formado por az´ ucares ligeramente diferentes a los del ADN –ribosa en lugar de desoxirribosa– y, adem´ as, una de las cuatro bases es diferente –uracilo (U) (ver Figura 1.4) en el lugar de la timina (T)–, pero las otras tres bases –A, C, G– son las mismas y se emparejan con su

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

10

Adenina (A)

Guanina (G) Purinas

Citosina (C)

Timina (T) (ADN)

Uracilo (U) (ARN)

Pirimidinas

Figura 1.4: Bases nitrogenadas complementaria, como en el ADN –la A, el U, la C y la G del ARN se unen con la T, la A, la G y la C del ADN, respectivamente. Durante la transcripci´ on, los mon´ omeros de ARN se seleccionan para la polimerizaci´ on del ARN sobre una cadena molde de ADN, de la misma manera que se seleccionan los mon´ omeros de ADN durante la replicaci´ on. El resultado de la transcripci´ on es un pol´ımero de ARN que contiene una parte de la informaci´ on gen´etica de la c´elula, aunque escrita en un alfabeto diferente de mon´ omeros del ARN en lugar de mon´ omeros de ADN. Un mismo fragmento de la secuencia del ADN se puede usar varias veces para guiar la s´ıntesis de muchos transcritos de ARN id´enticos. As´ı, mientras que el archivo de informaci´ on de la c´elula es fijo –en el ADN–, los transcritos de ARN se producen en gran n´ umero y son desechables. La funci´ on de la mayor´ıa de estos transcritos es servir de intermediarios en la transferencia de la informaci´ on gen´etica, actuando como un ARN mensajero (ARNm) que dirige la s´ıntesis de prote´ınas seg´ un las instrucciones almacenadas en el ADN. Las mol´eculas de prote´ına, como el ADN o el ARN, son largas cadenas no ramificadas que est´ an formadas por mon´ omeros tomados de un repertorio id´entico en todas las c´elulas vivas. Como el ADN y el ARN, las prote´ınas contienen la informaci´ on en forma de una secuencia lineal de s´ımbolos. Los mon´ omeros de

´ 1.1. CARACTER´ISTICAS UNIVERSALES DE LAS CELULAS

11

Timina Adenina

Citosina Guanina

Figura 1.5: Emparejamiento de bases las prote´ınas, los amino´ acidos, son muy diferentes de los del ADN o el ARN y, adem´ as, existen veinte tipos diferentes en lugar de tan s´ olo cuatro. Todos los amino´ acidos tienen una estructura central semejante por la que pueden unirse a los dem´ as amino´ acidos. Unido a esta estructura central, se encuentra un grupo lateral que confiere a cada amino´ acido su car´ acter qu´ımico caracter´ıstico. Cada una de las mol´eculas proteicas o polip´ eptido, formada por la uni´ on de varios amino´ acidos siguiendo una secuencia determinada, se pliega en una estructura tridimensional. Las prote´ınas tienen muchas funciones –ser catalizadores de reacciones (enzimas), mantener estructuras celulares, generar movimientos, traducir se˜ nales, etc.– y cada una cumple una funci´ on espec´ıfica seg´ un su secuencia de amino´ acidos, determinada gen´eticamente. Las prote´ınas son las mol´eculas que ponen en acci´ on la informaci´ on gen´etica de la c´elula. La informaci´ on contenida en la secuencia de ARNm se lee en grupos de tres nucle´ otidos; cada triplete de nucle´ otidos o cod´ on especifica (codifica) un amino´ acido de una prote´ına. Debido a que hay 64 posibles codones, pero s´ olo veinte amino´ acidos, necesariamente hay muchos casos en los que varios codones corresponden a un mismo amino´ acido. El c´ odigo se lee por una clase especial de peque˜ nas mol´eculas de ARN, el ARN de transferencia (ARNt). Cada

12

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

Figura 1.6: Doble h´elice tipo de ARNt une en uno de sus extremos un amino´ acido y tiene una secuencia espec´ıfica de tres nucle´ otidos en su otro extremo –un anticod´ on– que le permite reconocer un cod´ on o subgrupo de codones del ARNm por emparejamiento de bases. Para la s´ıntesis de prote´ınas, un conjunto de mol´eculas de ARNt cargadas con sus amino´ acidos respectivos se une a un ARNm por emparejamiento de sus anticodones con cada uno de los codones sucesivos del ARNm. Despu´es, los amino´ acidos se van uniendo de forma que la prote´ına naciente va creciendo y cada ARNt, relegado de su carga, se libera. Las mol´eculas de ADN son muy largas y contienen la especificaci´ on de miles de prote´ınas. Por tanto, fragmentos de esta secuencia completa de ADN se transcriben en diferentes mol´eculas de ARNm, cada uno de los cuales codifica una prote´ına diferente. Un gen se define como un fragmento de la secuencia de ADN que corresponde a una sola prote´ına (o a una mol´ecula de ARN catal´ıtica o estructural, para los genes que producen ARN pero no prote´ına). En todas las c´elulas, la expresi´ on de determinados genes est´ a regulada: en lugar de sintetizar el cat´ alogo completo de posibles prote´ınas en todo momento, la c´elula ajusta la velocidad de transcripci´ on y de traducci´ on de diferentes genes de forma independiente y de acuerdo con sus necesidades. En el ADN celular existen secuencias de ADN no codificantes –denominadas ADN regulador– que est´ an distribuidas entre las regiones codificantes de prote´ınas, y estas regiones no codificantes se unen a prote´ınas especiales que controlan la velocidad local de transcripci´ on. Existen tambi´en otras regiones no codificantes, algunas de las cuales act´ uan como elementos de puntuaci´ on, indicando el inicio y el final de la informaci´ on de una prote´ına. La regi´ on del ADN donde se establece c´ omo y

´ DE LOS SERES VIVOS 1.2. LA EVOLUCION

13

Enlace fosfodi´ ester

ADN

ARN

Figura 1.7: Polinucle´ otidos cu´ ando se expresar´ a el gen que se codifica en la regi´ on codificante inmediatamente adyacente se conoce como regi´ on promotora. En este sentido, el genoma de una c´elula –la totalidad de la informaci´ on gen´etica incluida en su secuencia completa de ADN– dicta no s´ olo la naturaleza de las prote´ınas celulares, sino tambi´en cu´ ando y d´ onde se sintetizar´ an.

1.2.

La evoluci´ on de los seres vivos

Los organismos vivos pueden clasificarse en dos grupos atendiendo a su estructura: los organismos eucariotas y los procariotas. Los eucariotas guardan su ADN en un compartimiento intracelular denominado n´ ucleo. Los procariotas no presentan un comportamiento nuclear diferenciado para almacenar su

14

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

ADN. Las plantas, los hongos y los animales son eucariotas; las bacterias son procariotas [5]. Tanto durante el almacenamiento como durante el copiado del material gen´etico se pueden producir accidentes y/o errores aleatorios que pueden alterar la secuencia de nucle´ otidos –es decir, generar mutaciones–. Como consecuencia de ello, cuando una c´elula se divide, a menudo sus dos c´elulas hijas no son id´enticas entre s´ı o a su progenitora. Algunas veces poco frecuentes, el error puede representar un cambio favorable; m´ as probablemente, el error no supondr´ a diferencias importantes en las capacidades de la c´elula; y en muchos casos, el error causar´ a da˜ nos importantes –por ejemplo, alterando la secuencia de una prote´ına clave–. Cambios debidos a errores del segundo tipo pueden ser o no perpetuados, dependiendo de si la c´elula o sus familiares tienen o no ´exito en la competencia por los recursos limitados del ambiente donde viven. Los cambios que causan da˜ nos importantes no conducen a la c´elula a ninguna parte, por lo general provocan su muerte, y por tanto, no dejan descendencia. Mediante la repetici´ on de este ciclo de ensayo y error –de mutaci´ on y selecci´ on natural– los organismos van evolucionando y sus especificaciones gen´eticas van cambiando, proporcion´ andoles nuevas v´ıas de aprovechamiento del entorno m´ as eficaces para poder sobrevivir en competencia con otros organismos, reproduci´endose con m´ as ´exito. Claramente, durante el curso de la evoluci´ on, algunas partes del genoma cambian m´ as f´ acilmente que otras. Un segmento de ADN que no codifica ninguna prote´ına y que no juega ning´ un papel regulador importante puede cambiar a una velocidad limitada u ´nicamente por la frecuencia de los errores aleatorios que sufra. Por el contrario, un gen que codifique una prote´ına esencial altamente optimizada o una mol´ecula de ARN no puede ser alterado tan f´ acilmente: cuando se produce un error, la c´elula afectada casi siempre es eliminada. El material b´ asico de la evoluci´ on es la secuencia de ADN que ya existe. No hay ning´ un mecanismo natural por el que se generen grandes cadenas de ADN de secuencia nueva aleatoria. As´ı, ning´ un ADN es completamente nuevo. La innovaci´ on puede ocurrir por diversas v´ıas: Mutaci´ on intrag´enica: un gen ya existente puede ser modificado por mutaciones en su secuencia de ADN. Duplicaci´ on g´enica: un gen existente puede ser duplicado, generando as´ı un par de genes muy relacionados en una misma c´elula. Mezcla de fragmentos: dos o m´ as genes existentes pueden romperse y reagruparse generando un gen h´ıbrido formado por segmentos de ADN que originariamente pertenec´ıan a genes independientes.

´ DE LOS SERES VIVOS 1.2. LA EVOLUCION

15

Transferencia horizontal (intracelular): un fragmento de ADN puede ser transferido desde el genoma de una c´elula al de otra c´elula –incluso de una especie diferente–. Este proceso contrasta con la transferencia vertical de informaci´ on gen´etica, habitual entre los progenitores y la progenie. Una c´elula ha de duplicar todo su genoma cada vez que se divide en dos c´elulas hijas. Sin embargo, algunos accidentes pueden causar la duplicaci´ on de una parte del genoma, manteniendo el genoma original. Cuando un gen se ha duplicado por esta v´ıa, una de las dos copias queda libre para mutar y especializarse en la realizaci´ on de una funci´ on diferente en la misma c´elula. Repetidos ciclos de este proceso de duplicaci´ on y divergencia, durante millones de a˜ nos, han permitido que algunos genes generen una familia completa de genes en un mismo genoma. Cuando los genes se duplican y divergen de esta manera, los individuos de una especie resultan dotados de diferentes variantes del gen inicial. Este proceso evolutivo ha de distinguirse de la divergencia gen´etica que ocurre cuando una especie se separa en dos l´ıneas de descendencia diferentes en una bifurcaci´ on del a´rbol de la vida. En este punto, los genes se vuelven diferentes en el curso de la evoluci´ on, pero contin´ uan teniendo funciones correspondientes en las dos especies hermanas. A los genes que est´ an relacionados de esta forma –es decir, genes de dos especies separadas que derivan de un mismo gen ancestral presente en el u ´ltimo ancestro com´ un de ambas especies– se los denomina ort´ ologos. A los genes relacionados que derivan de una duplicaci´ on en el mismo genoma –y que posiblemente divergir´ an en sus funciones– se los denomina par´ alogos. A los genes que est´ an relacionados por una descendencia de cualquier tipo se los denomina hom´ ologos, un t´ermino general que se utiliza para englobar ambos tipos de relaci´ on. Sin embargo, los intercambios horizontales de la informaci´ on gen´etica juegan un papel muy importante en la evoluci´ on bacteriana en el mundo actual. La reproducci´ on sexual genera una transferencia horizontal de informaci´ on gen´etica a gran escala entre dos linajes celulares inicialmente separados –los de la madre y del padre–. Independientemente de si esto ocurre entre especies o dentro de una misma especie, la transferencia horizontal de genes deja una huella caracter´ıstica: genera individuos que est´ an m´ as relacionados entre s´ı con un grupo de parientes con respecto a determinados genes y con otros con respecto a otro grupo de genes. Actualmente se cuenta con mucha informaci´ on sobre muchos genomas, sus secuencias completas y las funciones de muchos genes conocidos. En muchos casos, ya se habr´ a determinado experimentalmente la funci´ on de uno o m´ as de estos hom´ ologos, y como la secuencia g´enica determina la funci´ on del gen, frecuentemente podremos realizar una buena predicci´ on de la funci´ on del nuevo gen: es probable que sea similar a la de sus hom´ ologos.

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

16

Los organismos vivos son muy complejos, por lo que cuanto m´ as aprendemos acerca de una especie cualquiera, m´ as atractiva se vuelve como objetivo de estudios posteriores. Cada descubrimiento genera nuevas cuestiones y proporciona nuevas herramientas con las que podemos afrontar las preguntas en el organismo seleccionado. Por esta raz´ on, muchos grupos de investigaci´ on han dirigido sus esfuerzos a analizar diferentes aspectos de un mismo organismo modelo. En el enormemente variado mundo de las bacterias, el foco de atenci´ on de la biolog´ıa molecular ha sido la bacteria Escherichia coli o E. coli, la cual ser´ a utilizada en esta tesis.

1.3.

Separaci´ on, clonaci´ on y secuenciaci´ on de ADN

Hasta principios de los a˜ nos setenta, el ADN era la mol´ecula de la c´elula que planteaba m´ as dificultades para su an´ alisis bioqu´ımico. Actualmente, el ADN a pasado a ser la macro-mol´ecula m´ as f´ acil de estudiar. Ahora podemos separar una regi´ on determinada del ADN, obtener un n´ umero de copias casi ilimitado y determinar su secuencia de nucle´ otidos. Estos adelantos t´ecnicos en la ingenier´ıa gen´etica han tenido un impacto espectacular en la biolog´ıa celular, permitiendo el estudio de las c´elulas y de sus macro-mol´eculas mediante sistemas que antes eran inimaginables. La tecnolog´ıa del ADN recombinante constituye un conjunto variado de t´ecnicas, algunas de las cuales son nuevas y otras han sido adoptadas de otros campos de la ciencia, como la gen´etica microbiana. Las m´ as importantes son: La rotura espec´ıfica del ADN mediante nucleasas de restricci´ on, que facilita enormemente el aislamiento y la manipulaci´ on de los genes, individualmente. La clonaci´ on del ADN, con el uso de vectores de clonaci´ on o de la reacci´ on en cadena de la polimerasa, de tal forma que una mol´ecula sencilla de ADN puede ser reproducida generando muchos miles de millones de copias id´enticas. La hibridaci´ on de los a´cidos nucleicos, que hace posible localizar secuencias determinadas de ADN o de ARN con una gran exactitud y sensibilidad, utilizando la capacidad que tienen estas mol´eculas de unirse a secuencia complementaria de otros a´cidos nucleicos. La secuenciaci´ on r´ apida de todos los nucle´ otidos de un fragmento purificado de ADN, que hace posible identificar genes y deducir la secuencia de amino´ acidos de las prote´ınas que codifican.

´ CLONACION ´ Y SECUENCIACION ´ DE ADN 1.3. SEPARACION,

17

El seguimiento simult´ aneo del nivel de expresi´ on de cada uno de los genes de una c´elula, utilizando microchips de ADN (microarrays) que permiten efectuar simult´ aneamente decenas de miles de reacciones de hibridaci´ on. A continuaci´ on describiremos en m´ as detalle este u ´ltimo ´ıtem, que luego ser´ a utilizando en los cap´ıtulos posteriores. Como ya hemos comentado, las t´ecnicas cl´ asicas para el an´ alisis de secuencias permiten examinar la expresi´ on de un solo gen a la vez. Muchos de estos m´etodos son bastante laboriosos y el an´ alisis es limitado por el n´ umero de muestras que pueden cargarse a la vez en un gel de agarosa. Los microarrays, desarrollados en los a˜ nos noventa, han revolucionado la forma en la que actualmente se estudia la expresi´ on g´enica, al permitir el estudio de los productos de ARN de miles de genes a la vez. Al poder analizar simult´ aneamente la expresi´ on de tantos genes, hoy en d´ıa podemos empezar a identificar y estudiar los patrones de expresi´ on g´enica que subyacen a la fisiolog´ıa celular: podemos ver qu´e genes se encuentran activados (o inhibidos) durante el crecimiento de la c´elula, o cu´ ales responden a hormonas o a toxinas. Los microarrays de ADN no son m´ as que portaobjetos de microscop´ıa recubiertos con un gran n´ umero de fragmentos de ADN, cada uno de los cuales contiene una secuencia de nucle´ otidos que act´ ua como sonda para un gen concreto. Los microarrays m´ as densos contiene decenas de miles de estos fragmentos en un a´rea menor que el tama˜ no de un sello de correos y permiten desarrollar en paralelo miles de reacciones de hibridaci´ on. Para utilizar un microarray al estudiar la expresi´ on de un gen, primero se extrae el ARNm de las c´elulas que estemos estudiando y se transforma en ADNc. ´ Este se marca con un producto fluorescente, el microarray se incuba con esta muestra de ADNc marcado y se deja que tenga lugar la reacci´ on de hibridaci´ on. El microarray se lava para eliminar el ADNc que no se haya unido y se identifican las posiciones del microarray a las que se han unido los fragmentos de ADN marcado con un microscopio que tiene un esc´ aner l´ aser automatizado. Las posiciones detectadas por el esc´ aner se hacen corresponder con el gen concreto que hab´ıamos dispuesto inicialmente en esa posici´ on. Habitualmente el ADN fluorescente de las muestras experimentales (marcado, por ejemplo, con un pigmento rojo fluorescente) se mezcla con una muestra de fragmentos de ADNc de referencia marcados con un pigmento fluorescente de otro color (por ejemplo, de color verde) (ver Figura 1.8). Por tanto, si la cantidad de ARN expresada por un gen determinado de las c´elulas de inter´es se encuentra incrementada con respecto a la de la muestra de referencia, la mancha resultante es roja. Por el contrario, si la expresi´ on del gen es menor en relaci´ on a la muestra de referencia, la mancha resultante ser´ a verde. La utilizaci´ on de este tipo de referencia interna permite tabular los patrones de expresi´ on de los genes con gran precisi´ on.

18

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

Figura 1.8: Microarray

1.4.

Biolog´ıa computacional y Bioinform´ atica

En las u ´ltimas d´ecadas, los avances en la Biolog´ıa Molecular y el equipamiento disponible para la investigaci´ on en este campo han permitido la r´ apida secuenciaci´ on de grandes porciones de genomas de diversas especies. En la actualidad, varios genomas de bacterias, tales como Saccharomyces cerevisiae, y algunos eucariotas simples ya han sido secuenciados por completo. El proyecto Genoma Humano [24], dise˜ nado con el fin de secuenciar los 24 cromosomas del ser humano, tambi´en est´ a progresando. Las bases de datos de secuencias m´ as populares, como GenBank [16] y EMBL [55], est´ an creciendo de forma exponencial. Esta gran cantidad de informaci´ on necesita de un alto nivel de organizaci´ on, indexado y almacenamiento de las secuencias. Es por ello que la Inform´ atica ha sido aplicada a la Biolog´ıa para producir un nuevo campo de investigaci´ on llamado Bioinform´ atica que permita ayudar a esta organizaci´ on [9].

1.4.1.

Objetivos de la Bioinform´ atica

Las tareas m´ as simples de la Bioinform´ atica conciernen a la creaci´ on y mantenimiento de bases de datos de informaci´ on biol´ ogica. Secuencias nucleot´ıdicas (y las secuencias proteicas que derivan de las mismas) componen la mayor´ıa de la informaci´ on que est´ a almacenada en estos repositorios. Mientras que el almacenamiento y organizaci´ on de millones de nucle´ otidos est´ a muy lejos de ser una tarea trivial, el dise˜ no de una base de datos y el desarrollo de una interfaz con la cual los investigadores puedan tanto acceder a la informaci´ on existente

´ 1.4. BIOLOG´IA COMPUTACIONAL Y BIOINFORMATICA

19

como agregar nuevas instancias, es simplemente el comienzo. Tal vez, la tarea m´ as apremiante sea la que involucra el an´ alisis de la informaci´ on de secuencias. Biolog´ıa Computacional es el nombre dado a este proceso e involucra las siguientes tareas: Encontrar genes en secuencias de ADN pertenecientes a varios organismos. Desarrollar m´etodos para la predicci´ on de la estructura y/o la funci´ on de nuevas prote´ınas y secuencias estructurales de ARN. Agrupar secuencias de prote´ınas en familias de secuencias relacionadas y el desarrollo de modelos de prote´ınas. Alinear prote´ınas similares y generar a´rboles filogen´eticos para examinar las relaciones de la evoluci´ on. El proceso de evoluci´ on ha producido secuencias de ADN que codifican prote´ınas con funciones muy espec´ıficas. Es posible predecir la estructura tridimensional de una prote´ına usando algoritmos derivados de nuestros conocimientos en el campo de la F´ısica, la Qu´ımica y, en mayor medida, del an´ alisis de otras prote´ınas con secuencias de amino´ acidos similares. La mayor´ıa de las bases de datos biol´ ogicas consisten en largas secuencias nucleot´ıdicas y/o secuencias de amino´ acidos. Cada secuencia representa un gen o prote´ına particular (o una secci´ on de la misma), respectivamente. Mientras que la mayor´ıa de las bases de datos biol´ ogicas contienen este tipo de informaci´ on, tambi´en existen otros repositorios que incluyen informaci´ on taxon´ omica tales como caracter´ısticas estructurales o bioqu´ımicas de los organismos. Sin embargo, el poder y la facilidad de utilizar la informaci´ on de secuencias hizo que ´ese sea el m´etodo elegido en el an´ alisis moderno. En las u ´ltimas tres d´ecadas, las contribuciones al a´rea de la Biolog´ıa y de la Qu´ımica han facilitado el aumento en la velocidad del proceso de secuenciaci´ on de genes y prote´ınas. El advenimiento de la tecnolog´ıa de clonaci´ on ha permitido que secuencias de ADN for´ aneas sean introducidas en bacterias. De esta manera fue posible la r´ apida producci´ on de secuencias de ADN particulares, un preludio necesario para la determinaci´ on de secuencias. La s´ıntesis de oligonucle´ otidos dio a los investigadores la habilidad de construir peque˜ nos fragmentos de ADN con secuencias elegidas por ellos mismos. Estos oligonucle´ otidos son luego utilizados como parte de bibliotecas de ADN y permiten la extracci´ on de genes que contengan esta secuencia. Estos fragmentos de ADN tambi´en pueden ser utilizados en reacciones en cadena de polimerizaci´ on para amplificar secuencias de ADN o modificar estas secuencias. Mediante estas t´ecnicas, el progreso de la investigaci´ on biol´ ogica ha crecido exponencialmente. Sin embargo, para que los investigadores puedan beneficiarse de esta informaci´ on, es necesario cumplir con dos requisitos: (1) tener acceso inmediato al

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

20

conjunto de secuencias coleccionadas y (2) tener una forma de extraer de este conjunto solamente aquellas secuencias que interesen al investigador. La simple colecci´ on, de forma manual, de toda la informaci´ on necesaria para un proyecto dado a partir de un art´ıculo de revista publicado puede convertirse r´ apidamente en una tarea epop´eyica. Luego de obtener estos datos, es necesario organizarlos y analizarlos. La b´ usqueda manual de genes y prote´ınas relacionadas puede llevarle semanas e incluso meses a un investigador. La tecnolog´ıa inform´ atica ha proporcionado la soluci´ on obvia a este problema. Los ordenadores, no solo pueden acumular y organizar la informaci´ on de secuencias en bases de datos, sino que tambi´en pueden analizar los datos de las secuencias muy r´ apidamente. La evoluci´ on del poder computacional y la capacidad de almacenamiento ha logrado lidiar con la creciente cantidad de informaci´ on de secuencias que est´ a siendo creada. Los cient´ıficos te´ oricos han desarrollado sofisticados algoritmos que permiten comparar secuencias mediante teor´ıa de probabilidades. Estas comparaciones se han convertido en la base de la determinaci´ on de la funci´ on de genes, desarrollando relaciones filogen´eticas y simulando modelos de prote´ınas. La colecci´ on, organizaci´ on e indexado de la informaci´ on de secuencias en una base de datos es una tarea desafiante por s´ı misma y ha generado una gran cantidad de informaci´ on pero de uso limitado. El poder de una base de datos no proviene de la colecci´ on de informaci´ on que tenga, sino de su an´ alisis. Una secuencia de ADN no necesariamente constituye un gen, puede constituir solamente un fragmento de un gen o contener varios genes. La investigaci´ on cient´ıfica actual, en acuerdo con los principios de la evoluci´ on, muestra que todos los genes tienen elementos comunes. Para muchos elementos gen´eticos es posible construir secuencias consenso, las cuales representan de la mejor manera posible la norma de una clase dada de organismo. Algunos elementos gen´eticos comunes incluyen promotores, reforzadores, se˜ nales de poliadenizaci´ on y sitios de binding de prote´ınas. Para estos elementos tambi´en se conocen algunas caracter´ısticas de sus subelementos. Los elementos gen´eticos comunes comparten secuencias similares, siendo ´este el hecho que permite la aplicaci´ on de algoritmos al an´ alisis de secuencias biol´ ogicas.

1.4.2.

Problemas cl´ asicos de la bioinform´ atica

A continuaci´ on se enunciar´ an algunos problemas cl´ asicos de la bioinform´ atica [85]. 1.4.2.1.

Reconocimiento de patrones

“Dadas una secuencia biol´ ogica y una base de datos de estas mismas secuencias, indicar qu´e secciones de la secuencia dada tienen alguna

´ 1.4. BIOLOG´IA COMPUTACIONAL Y BIOINFORMATICA

21

similitud con aquellas existentes en el repositorio.” Los m´etodos de reconocimiento de patrones, como sugiere su nombre, se basan en el supuesto de que alguna caracter´ıstica subyacente de una secuencia o estructura biol´ ogica puede emplearse para identificar caracteres semejantes en secuencias emparentadas. En otras palabras, si se mantiene o conserva parte de una secuencia o estructura, esta caracter´ıstica puede emplearse para determinar nuevos miembros de la familia. Si se extraen tales caracteres conservados de familias de secuencias conocidas y se archivan en bases de datos, entonces las secuencias reci´en secuenciadas pueden ser analizadas r´ apidamente para determinar si contienen esas caracter´ısticas familiares previamente reconocidas. En la actualidad, se emplean de forma habitual b´ usquedas en bases de datos de patrones de secuencias y estructuras para el diagn´ ostico de relaciones familiares y, en consecuencia, para inferir estructuras y funciones de secuencias reci´en determinadas. 1.4.2.2.

El problema de la b´ usqueda de genes

“Dada una secuencia de ADN, predecir la ubicaci´ on de genes (marcos de lectura abiertos), exones e intrones.” Una soluci´ on simple podr´ıa ser buscar los codones de parada en regiones a lo largo de la secuencia. Claramente, si varios codones de parada aparecen cerca unos de otros en esta regi´ on, entonces es muy probable que la secuencia correspondiente al gen ya hubiera terminado, por ello se puede asumir con seguridad que no es una regi´ on codificante. Detectar una secuencia relativamente larga que no contenga codones de parada indica una regi´ on codificante. El problema se complica en ADN eucari´ otico debido a la existencia de exones e intrones. Por otro lado, una complejidad adicional surge del hecho que ciertas secuencias de ADN pueden ser interpretadas de seis maneras diferentes dependiendo del marco de lectura, como ya se ha mencionado. En la mayor´ıa de los casos, en organismos eucariotas, una regi´ on de ADN codifica s´ olo un gen, lo cual puede no ser necesariamente cierto para procariotas. 1.4.2.3.

El problema del alineamiento de secuencias

“Dadas dos secuencias de ADN o de prote´ınas, encontrar el mejor emparejamiento entre ellas.” Para poder realizar un alineamiento, es necesario definir un conjunto de operaciones posibles con sus correspondientes penalidades. Por ejemplo, un fen´ omeno biol´ ogico como la inserci´ on puede ser matem´ aticamente traducido en una acci´ on de abrir un espacio (gap), lo cual acarrea una penalizaci´ on. De esta manera, se pueden caracterizar otras propiedades como las deleciones, errores en el alineamiento, desplazamientos de marco, etc., cada una con su penalidad

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

22

espec´ıfica de acuerdo a su frecuencia biol´ ogica y su gravedad. Este problema tambi´en es extensible a m´ ultiples secuencias. 1.4.2.4.

El problema del rearreglo gen´ omico

“Dadas dos permutaciones de un conjunto de segmentos gen´ omicos, encontrar el conjunto m´ınimo de operaciones para transformar una permutaci´ on en otra.” Los eventos de reorganizaci´ on son raros comparados con mutaciones puntuales. Por ejemplo, una sustituci´ on en un organismo ocurre diez veces en cada generaci´ on, mientras que un rearreglo no fatal ocurre una vez cada 5 a 10 millo´ nes de a˜ nos. Esta baja tasa de rearreglos permite detectar un proceso evolutivo direccional, dado que la posibilidad de reversi´ on es m´ınima. Por lo tanto, descubrir qu´e eventos de reorganizaci´ on han ocurrido, y el orden de estos eventos, puede permitir construir una hip´ otesis evolutiva. 1.4.2.5.

El problema del plegado de prote´ınas

Debido a que la funcionalidad de una prote´ına est´ a determinada por su estructura 3D, es muy importante predecir su estructura, con lo que se consigue un mejor entendimiento de su rol en la c´elula. “Dada una secuencia de amino´ acidos, predecir la estructura tridimensional de la prote´ına.” Este problema a´ un no ha sido resulto, es decir, es un problema abierto y en el cual se est´ a trabajando continuamente. Sin embargo, se han desarrollado varios acercamientos para aproximar la estructura de una prote´ına: Modelado por homolog´ıa. Utiliza una base de datos de prote´ınas para buscar secuencias similares. Si se encuentra una prote´ına que tiene una identidad de aproximadamente un 30 %, entonces es bastante seguro asumir que las dos prote´ınas tienen estructuras similares. Threading. Clasifica las estructuras conocidas en familias con plegados similares. Dada una secuencia de amino´ acidos, se puede seleccionar la familia a la cual es m´ as probable que pertenezca la prote´ına. 1.4.2.6.

El problema de la regulaci´ on de genes

“Dado un conjunto de genes de un genoma, obtener la red de interacciones entre este conjunto, determinando c´ omo, cu´ ando y qu´e genes se activan o reprimen.”

´ 1.4. BIOLOG´IA COMPUTACIONAL Y BIOINFORMATICA

23

Las redes de regulaci´ on de genes son b´ asicamente interruptores de encendido´ apagado de una c´elula que funcionan al nivel de genes. Estos orquestan din´ amicamente el nivel de la expresi´ on para cada gen en el genoma, controlando cu´ ando y c´ omo ese gen ser´ a transcrito en ARN. La comprensi´ on de los mecanismos de funci´ on celular requiere un estudio exhaustivo del complejo comportamiento de un conjunto de genes interactuando. Actualmente, el modelo formal m´ as usado y aceptado es la red booleana. En este modelo, los estados de un gen se representan por “1” si el gen est´ a activado y “0” si no. La dependencia entre los genes se representa por un enlace funcional entre ellos, y el estado de cada gen es determinado por sus entradas y una funci´ on booleana asociada. A pesar de su aparente simplicidad, las redes de regulaci´ on gen´etica son procesos complejos, en los cuales forman parte muchos componentes que afectan directa o indirectamente en la regulaci´ on de la expresi´ on.

24

´ CAP´ITULO 1. BIOLOG´IA Y BIOINFORMATICA

Cap´ıtulo

2

Preliminares

E

n este cap´ıtulo se introducir´ an los conceptos b´ asicos sobre diferentes m´etodos y algoritmos computacionales que constituir´ an la base sobre la cual se apoyar´ a nuestro trabajo. Los temas que se explicar´ an en las pr´ oximas secciones corresponden a los conceptos de modelado de sistemas, l´ ogica difusa, algoritmos de clustering (agrupamiento), algoritmos evolutivos, en particular algoritmos gen´eticos y la programaci´ on gen´etica, y, finalmente, t´ecnicas de optimizaci´ on multiobjetivo.

2.1.

Modelado de sistemas

Cada vez que resolvemos un problema correspondiente al mundo real, debemos comprender que, en realidad, solamente estamos encontrando la soluci´ on de un modelo del problema [65]. Todos los modelos son simplificaciones del mundo real, de otro modo ser´ıan tan complejos e intrincados como lo es el escenario natural. El problema que existe con los modelos es que cada uno de ellos debe hacer una serie de asunciones respecto del problema real, en otras palabras, dejar algo de ´este a un lado. En consecuencia, el error m´ as frecuente que existe cuando tratamos con modelos es olvidar dichas asunciones. En este sentido, un problema puede tener varias soluciones correctas posibles, tan solo dependientes de c´ omo fue construido el modelo del mismo. El proceso de resoluci´ on de un problema consiste b´ asicamente en dos pasos generales que se dan por separado: Creaci´ on de un modelo del problema. Utilizaci´ on de ese modelo para la generaci´ on de una soluci´ on: P roblema ⇒ M odelo ⇒ Soluci´ on 25

26

CAP´ITULO 2. PRELIMINARES

Tal como hemos dicho, la soluci´ on de un problema est´ a dada solamente en t´erminos del modelo y depende de su grado de fidelidad. Esto es, confiamos en que el mejor modelo produzca la mejor soluci´ on. Sin embargo, algunas veces los modelos m´ as perfectos resultan in´ utiles para que un m´etodo de soluci´ on preciso decida qu´e hacer, es decir, permita derivar una soluci´ on basada en dicho modelo. En esta memoria, trataremos con modelos (M odeloα ) y soluciones (Soluci´ onα ) aproximadas, con el prop´ osito de representar y resolver de la mejor manera posible cierta clase de problemas biol´ ogicos para los cuales, debido a su nivel de complejidad e imprecisi´ on, resulta dif´ıcil obtener una soluci´ on adecuada. En este sentido, la construcci´ on de modelos basados en la l´ ogica difusa (ver Secci´ on 2.2) ha adquirido un gran inter´es gracias a que proporciona mayor generalidad, poder expresivo y tolerancia frente a la imprecisi´ on. El desarrollo de modelos matem´ aticos de sistemas reales es un t´ opico central en diferentes disciplinas como la ingenier´ıa y las ciencias. Como hemos mencionado, dichos modelos sirven para resolver problemas reales a trav´es de simulaciones, an´ alisis del comportamiento de un sistema, dise˜ no de nuevos procesos para controlar sistemas, predicciones, etc. El desarrollo inadecuado de dichos modelos puede conducir a la obtenci´ on de resultados no exitosos y err´ oneos de los sistemas en cuesti´ on. Gran parte de estos sistemas actuales comparten una serie de caracter´ısticas que dificultan su modelado con t´ecnicas tradicionales, tales como: necesidad de una importante precisi´ on, tratamiento y respuestas en tiempo real, carencia de conocimiento formal sobre su funcionamiento, posesi´ on de un comportamiento fuertemente no lineal, con alto grado de incertidumbre y caracter´ısticas con variaciones en el tiempo. Ejemplos de esta clase de problemas son los procesos complejos de los sistemas de ingenier´ıa aeroespacial o bioqu´ımica, aunque tambi´en se encuentran en sistemas ecol´ ogicos, sociales o correspondientes al a´rea econ´ omico-financiera. A continuaci´ on plantearemos al menos tres paradigmas diferentes en cuanto a la tarea de modelado, es decir, de la comprensi´ on de la naturaleza y el comportamiento de un sistema, y la consecuente tarea de creaci´ on de un modelo que pueda ser posteriormente utilizado [10]: Modelado de caja blanca. Tradicionalmente, el modelado de datos se ha visto como una conjunci´ on de una actividad que permite la comprensi´ on de la naturaleza del sistema y su comportamiento, y de un tratamiento matem´ atico adecuado que conduce hacia la realizaci´ on de un modelo utilizable. Este enfoque, denominado modelado de “caja blanca”, est´ a limitado en la pr´ actica cuando se emplean sistemas complejos y poco comprensibles. Como consecuencia directa de este planteamiento, los sistemas no lineales se simplifican, pasando a ser tratados como sistemas lineales, debido a la imposibilidad de comprender su mecanismo de funcionamiento.

2.1. MODELADO DE SISTEMAS

27

En vista del diagrama previamente empleado, observamos esta situaci´ on de modelado como: P roblema ⇒ M odeloα ⇒ Soluci´ onp lo que corresponde a solucionar un modelo simplificado (α) de un problema por medio de un m´etodo (p) que produce soluciones o´ptimas y precisas. Modelado de caja negra. Este es un planteamiento diferente que consiste en estimar los par´ ametros del modelo en base a los datos de entrada disponibles. A pesar de que estos modelos generalmente pueden ser desarrollados de forma bastante f´ acil, la estructura identificada no posee un significado f´ısico claro. Estos modelos resultan dif´ıcilmente escalables y el comportamiento real del sistema puede ser solamente analizado a trav´es de la simulaci´ on num´erica. Un inconveniente com´ un de la mayor´ıa de estas t´ecnicas de modelado es que no permiten el uso efectivo de informaci´ on adicional, tal como conocimiento y experiencia de expertos, y operaciones previas, las cuales son imprecisas y cualitativas por naturaleza. Nuevamente, esto puede ser visto como: P roblema ⇒ M odelop ⇒ Soluci´ onα Es decir, un modelo muy preciso solucionado por un m´etodo cercano al o´ptimo, por tanto, una soluci´ on aproximada. Modelado de caja gris. Los hechos descritos anteriormente motivan el desarrollo de t´ecnicas de modelado h´ıbrido o de “caja gris”, que combinan las ventajas de los enfoques de tipo caja blanca, utilizando conocimiento f´ısico para modelar las partes conocidas del sistema, y de los de caja negra, para aproximar las partes m´ as inciertas. Para realizar esto, se han introducido algunas metodolog´ıas inteligentes, las cuales emplean t´ecnicas motivadas por sistemas biol´ ogicos e inteligencia humana (lenguaje natural, reglas, redes sem´ anticas o modelos cualitativos) para desarrollar modelos y controladores para sistemas din´ amicos. En consecuencia, obtenemos una soluci´ on aproximada de un problema en base a un modelo aproximado, con el prop´ osito de ser interpretable y tan preciso como se pueda. Podemos distinguir as´ı varias clases de modelos aproximados, esto es, con distinto grado de precisi´ on (β): P roblema ⇒ M odeloβ ⇒ Soluci´ on α Debemos se˜ nalar que un modelo aproximado de un problema no necesariamente es una simplificaci´ on del mismo, sino que por el contrario puede

CAP´ITULO 2. PRELIMINARES

28

ser una descripci´ on a´ un m´ as precisa que la dada por un modelo de caja blanca. Esto se debe a que estos modelos son capaces de captar la imprecisi´ on e incertidumbre de los problemas del mundo real, que muchas veces son asunciones o excepciones no tenidas en cuenta en el otro caso.

2.2.

L´ ogica difusa

La l´ ogica difusa es una teor´ıa de reciente aparici´ on que se atribuye al investigador Lofti Zadeh. En lo que se considera como el trabajo seminal de la teor´ıa de conjuntos difusos [92] y su posterior aportaci´ on sobre el concepto de variable ling¨ u´ıstica [93], este investigador proporcion´ o las bases para el entendimiento y tratamiento de la incertidumbre de forma cualitativa o mediante t´erminos ling¨ u´ısticos. Con car´ acter general, la representaci´ on del conocimiento ha sido una de las a´reas de mayor inter´es investigadas en la disciplina de las ciencias de la computaci´ on y la inteligencia artificial. Uno de los principales aspectos tratados es el de c´ omo representar el conocimiento que es ling¨ u´ısticamente impreciso, para cuya representaci´ on se han mostrado ineficaces las t´ecnicas convencionales. Debemos ser conscientes de que los m´etodos que tradicionalmente se utilizaban para tratar la informaci´ on hac´ıan uso de datos precisos (cuantitativos), intentando aportar una visi´ on predictiva basada en procesos deterministas. Sin embargo, no resultan u ´tiles cuando se aplican como apoyo de procesos de razonamiento que cuentan con informaci´ on incierta o definida de manera imprecisa. En este sentido, el desarrollo de la l´ ogica difusa se vio motivado por la necesidad de un marco conceptual que pudiese aplicarse con ´exito al tratamiento de la informaci´ on en entornos de incertidumbre e imprecisi´ on l´exica [94]. La l´ ogica difusa pude ser vista como una extensi´ on a la l´ ogica cl´ asica, donde se incorporan nuevos conceptos para trabajar con el problema de representaci´ on en un ambiente de incertidumbre e imprecisi´ on. La l´ ogica difusa, como su nombre sugiere, es una forma de l´ ogica cuya forma de razonamiento subyacente es m´ as aproximada que exacta. La diferencia fundamental entre las proposiciones de la l´ ogica cl´ asica y las proposiciones difusas est´ a en el rango de valores de verdad. Mientras que en las proposiciones cl´ asicas s´ olo existen dos posibles valores de verdad (verdadero o falso), el grado de verdad o falsedad de las proposiciones difusas puede tomar distintos valores num´ericos. Asumiendo que la verdad y la falsedad se representan con 1 y 0 respectivamente, el grado de verdad de cada proposici´ on difusa se expresa como un valor en el intervalo [0,1]. La l´ ogica difusa es, en realidad, una forma de l´ ogica multivaluada. Su finalidad u ´ltima es proveer de una base para el razonamiento aproximado con proposiciones imprecisas utilizando la teor´ıa de conjuntos difusos como herramienta principal. El paso de la l´ ogica cl´ asica a la difusa que acabamos de comentar tiene serias implicaciones, como no puede ser de otra manera, sobre la teor´ıa de conjuntos.

´ 2.2. LOGICA DIFUSA

29

Si un conjunto se utiliza para clasificar los elementos de un universo de estudio, en determinadas situaciones (aquellas no deterministas o definidas de manera vaga) no se deben obtener los mismos resultados si se utilizan los principios de la l´ ogica cl´ asica a si se utilizan los de la l´ ogica difusa. De forma previa a la introducci´ on de los conjuntos difusos, partamos de lo que se entiende por un conjunto cl´ asico, tambi´en denominados como conjuntos crisp, mediante la siguiente definici´ on [72]: un conjunto cl´ asico A del universo de discurso o dominio X, puede representarse haciendo uso de la siguiente funci´ on caracter´ıstica µA : X → 0, 1 del conjunto A si y solo si para todo x:  1 si x ∈ A (2.1) µA (x) = 0 si x ∈ /A donde X es el universo de discurso y A un conjunto definido en dicho discurso. Como se puede observar, la funci´ on caracter´ıstica que define los conjuntos cl´ asicos es un caso t´ıpico de funci´ on booleana, de verdadero o falso, expresado num´ericamente como 1 o´ 0. Tambi´en se denomina como funci´ on discriminante porque discrimina los elementos del universo de discurso entre aquellos que pertenecen al conjunto definido y aquellos que no. Por tanto, se tratan de conjuntos de elementos cuyos l´ımites est´ an fijados de forma determinista. Por tanto, de manera previa a la resoluci´ on de la pregunta que planteamos, definamos lo que se entiende por un conjunto difuso [72]: un conjunto difuso A en el universo de discurso X es un conjunto de pares ordenados de un elemento gen´erico x y su correspondiente grado de pertenencia µ A (x), de manera que A = {(x, µA (x)) / x ∈ X}. Por tanto, como puede apreciarse, la definici´ on de un conjunto difuso es similar a la de un conjunto cl´ asico, con la sustancial salvedad de que cada elemento perteneciente al universo de discurso tiene asociado un grado de pertenencia a dicho conjunto difuso. Por tanto, los conjuntos crisp se pueden considerar como un caso espec´ıfico de conjuntos difusos, en tanto que 0, 1 ∈ [0, 1]. Existen siete tipos de funciones de pertenencia t´ıpicas: Triangular, Gamma, S, Gaussiana, Trapezoidal, Pseudo-exponencial y de Trapecio extendido. Las funciones m´ as utilizadas son de la clase triangular, trapezoidal y gaussiana. Las dos primeras se basan en un comportamiento lineal de la funci´ on de pertenencia, mientras que la gaussiana se caracteriza por un comportamiento no lineal de dicha funci´ on. Es incorrecto asumir que un conjunto difuso indica, de alguna manera, alguna forma de probabilidad. A pesar del hecho que pueden llegar a tomar valores en un mismo intervalo de definici´ on, es importante comprender que los grados de pertenencia no son probabilidades. Una diferencia aparentemente inmediata es que la suma de las probabilidades en un conjunto universal debe ser 1, mientras esto no es un requisito para los conjuntos difusos. Ya hemos destacado que los conjuntos difusos son extensiones o generalizaciones de los conjuntos cl´ asicos o crisp de la l´ ogica bivaluada. Por tanto, las

30

CAP´ITULO 2. PRELIMINARES

mismas operaciones que se determinan para los conjuntos crisp pueden determinarse igualmente para los conjuntos difusos, con el a˜ nadido de que existen unos grados de pertenencia asociados. Asimismo, los conjuntos resultantes de las operaciones con conjuntos difusos son tambi´en difusos. Las principales operaciones b´ asicas que se van a presentar son: la igualdad, la inclusi´ on, la intersecci´ on o conjunci´ on, la uni´ on, y el complemento. Igualdad. Para que se considere que dos conjuntos difusos son iguales, se deber´ a satisfacer la condici´ on siguiente: A = B ⇔ ∀x ∈ X ; µA (x) = µB (x)

(2.2)

Inclusi´ on. Se considera que un conjunto difuso A es un subconjunto de B si: A ⊆ B ⇔ ∀x ∈ X ; µA (x) ≤ µB (x)

(2.3)

Intersecci´ on. La intersecci´ on entre dos conjuntos difusos se puede obtener mediante el m´ınimo de ambos: µA∩B (x) = min{µA (x), µB (x)}

(2.4)

Uni´ on. Por el contrario, para la uni´ on de dos conjuntos difusos se considera el m´ aximo en los grados de pertenencia de los elementos del universo de discurso:

µA∪B (x) = max{µA (x), µB (x)}

(2.5)

¯ de un conjunto difuso A con respecto Complemento. El complemento, A, al conjunto universal X se define para todo elemento x ∈ X como: ¯ A(x) = 1 − A(x)

(2.6)

Por otro lado, existen generalizaciones de las operaciones anteriores, puesto que tanto las funciones de pertenencia de los conjuntos difusos como sus operaciones dependen del contexto en el que se apliquen. En este respecto, para poder aplicar la l´ ogica difusa en un sistema inform´ atico basado en reglas es preciso que se pueda trabajar con los operadores “Y” y “O”, es decir. la intersecci´ on y la uni´ on respectivamente. La familia de funciones que se utilizan para tal fin se conocen como T-normas y T-conormas. Una T-norma generaliza el concepto de intersecci´ on de forma que

2.3. CLUSTERING

31

T : [0, 1] × [0, 1] → [0, 1] µA∩B = T [µA (x), µB (x)]

(2.7) (2.8)

y adem´ as satisface las siguientes propiedades: Conmutativa: T (a, b) = T (b, a) Asociativa: T (a, T (b, c)) = T (T (a, b), c) Monoton´ıa: T (a, b) ≥ T (c, d), si a ≥ c y b ≥ d Condiciones frontera: T (a, 1) = a En segundo lugar, la T-conorma, tambi´en conocida como S-norma, generaliza el concepto de uni´ on de forma que S : [0, 1] × [0, 1] → [0, 1] µA∪B = S[µA (x), µB (x)]

(2.9) (2.10)

y adem´ as satisface las siguientes propiedades: Conmutativa: S(a, b) = S(b, a) Asociativa: S(a, S(b, c)) = S(S(a, b), c) Monoton´ıa: S(a, b) ≥ S(c, d), si a ≥ c y b ≥ d Condiciones frontera: S(a, 0) = a En resumen, la utilizaci´ on de funciones triangulares para la intersecci´ on y/o uni´ on de conjuntos difusos ofrece un abanico bastante extenso para realizar estas operaciones, y, por tanto, para calcular las T-normas y T-conormas en las que se basar´ an las funciones de pertenencia resultantes. Asimismo, su flexibilidad permite que el investigador proponga sus propias f´ ormulas con el objeto de adaptarse mejor a las caracter´ısticas de los conjuntos difusos con los que trabaje.

2.3.

Clustering

El objetivo del agrupamiento de datos (clustering) es la clasificaci´ on de objetos de acuerdo a similitudes entre ellos, para luego organizar estos datos en grupos. Las t´ecnicas de clustering est´ an incluidas entre los m´etodos de aprendizaje no supervisado, debido a que no utilizan conocimiento de identificadores de clases. La mayor´ıa de los algoritmos de clustering tampoco se basan en asunciones comunes a los m´etodos estad´ısticos convencionales, tales como la distribuci´ on

CAP´ITULO 2. PRELIMINARES

32

estad´ıstica subyacente de los datos, y por ello son u ´tiles en situaciones donde existe poco conocimiento sobre los mismos. El potencial de los algoritmos de clustering para revelar las estructuras subyacentes de los datos puede ser explotado no s´ olo para la clasificaci´ on y reconocimiento de patrones sino tambi´en para la reducci´ on de la complejidad en modelado y optimizaci´ on. Las t´ecnicas de clustering pueden aplicarse a datos que sean cuantitativos (num´ericos), cualitativos (categ´ oricos) o una mezcla de ambos. Los datos son t´ıpicamente observaciones de alg´ un proceso f´ısico. Pueden formularse varias definiciones de cluster, dependiendo del n´ umero de objetivos del clustering. Generalmente, uno puede aceptar la visi´ on de que un cluster es un grupo de objetos, los cuales son m´ as similares entre s´ı que los miembros de otros clusters. El t´ermino “similaridad” deber´ıa ser entendido como la similaridad matem´ atica, medida formalmente. En espacios m´etricos, la similaridad est´ a definida com´ unmente como una norma de distancia. La distancia puede medirse entre los vectores de datos en s´ı, o como la distancia de un vector de datos a alg´ un objeto protot´ıpico del cluster. Los prototipos no son usualmente conocidos de antemano y los algoritmos de clustering los buscan simult´ aneamente con la partici´ on de los datos. Los prototipos pueden ser vectores de igual dimensi´ on que la de los objetos de datos, pero se pueden tambi´en definir como objetos geom´etricos de “alto nivel”, tales como subespacios lineales y no-lineales, o funciones.

(a)

(b)

(c)

(d)

Figura 2.1: Diferentes formas de los clusters

2.3. CLUSTERING

33

Los datos pueden revelar clusters de diferentes formas geom´etricas, tama˜ nos y densidades, como se puede ver en la Figura 2.1. Mientras que los clusters (a) son esf´ericos, los clusters (b), (c) y (d) pueden caracterizarse como subespacios lineales y no-lineales del espacio de datos. El rendimiento de la mayor´ıa de los algoritmos de clustering est´ a influenciado no solo por la forma geom´etrica y densidad de los clusters individuales, sino tambi´en por las relaciones espaciales y distancias entre ellos. Los clusters pueden estar bien separados, conectados en forma continua, o solapados entre ellos. La separaci´ on de los clusters est´ a influenciada por el factor de escala y la normalizaci´ on de los datos. Se han propuesto muchos algoritmos de clustering en la literatura. Dado que los clusters pueden verse formalmente como subconjuntos del conjunto de datos, una posible clasificaci´ on de los m´etodos de clustering puede ser de acuerdo a si los subconjuntos son difusos o crisp. Los m´etodos de clustering crisp est´ an basados en la teor´ıa cl´ asica de conjuntos y requieren que un objeto pertenezca o no a un cluster dado. Un clustering crisp significa particionar los datos en un n´ umero especificado de subconjuntos mutuamente excluyentes. Los m´etodos de clustering difuso, sin embargo, permiten a los objetos pertenecer a varios clusters simult´ aneamente, con distinto grado de pertenencia. En muchas situaciones, los clusters difusos son un concepto m´ as natural que los clusters crisp, dado que los objetos en las fronteras de algunas clases no est´ an forzados a pertenecer completamente a una de ellas. En lugar de ello, se les asignan grados de pertenencia entre 0 y 1 indicando su pertenencia parcial. A continuaci´ on se mostrar´ a como ejemplo el algoritmo de clustering difuso C-medias. Clustering difuso C-medias. Este m´etodo de clustering es una extensi´ on del m´etodo de clustering tradicional k-medias, donde los elementos pueden pertenecer a m´ as de un cluster con distinto grado de pertenencia. Por ejemplo, el grado de pertenencia de una instancia k con un valor x k a un cluster particular Vi se calcula como: "  1 #−1  kxk − Vi k2A m−1 ui,k = 1 + ; ∀i, k; 1 < m ≤ ∞ (2.11) wi donde las c-particiones de los datos X se suelen almacenar en una matriz dimensi´ on c × n que contiene el vector donde se representan los grados de similaridad entre las n instancias y las c-particiones de un tipo de caracter´ıstica; u i,k corresponde al grado de pertenencia del valor xk en la partici´ on difusa i-´esima de X; m representa el grado de imprecisi´ on (fuzzification degree); A determina el tipo de norma utilizada, como puede ser la norma euclidiana (A = 2); y w i es un peso para penalizaci´ on de los t´erminos, el cual se sustituye por 1 en ausencia de informaci´ on externa. Si el enfoque es probabil´ıstico, ui,k generalmente corresponde a la probabilidad a posteriori p(i|xk ) de que, dado xk , provenga de la clase i siguiendo la

CAP´ITULO 2. PRELIMINARES

34

regla de Bayes [18, 19, 66]. Si el enfoque es difuso, xk puede provenir de m´ as de una clase. El centroide del cluster de la partici´ on Vi se calcula como: Pn m k=1 ui,k xk ∀i (2.12) Vi = P n m k=1 ui,k

f´ ormula basada en el uso de la distancia Eucl´ıdea como funci´ on de similaridad: q (2.13) kx − V k2 = (x − V )T (x − V ) En resumen, los pasos a seguir se muestran en el Algoritmo 2.1.

Algoritmo 2.1 Clustering difuso c-medias C-MEDIAS(T n´ umero m´ aximo de iteraciones, c n´ umero de particiones) 1: Inicializar V0 = {v1 , . . . , vc } 2: mientras t < T y kVt − Vt−1 k >  hacer 3: Calcular Ut en base a Vt−1 4: Actualizar Vt en base a Vt−1 y Ut 5: fin mientras

2.3.1.

Clustering conceptual

El agrupamiento conceptual (conceptual clustering) es similar al considerado en el an´ alisis de clusters tradicional, pero est´ a definido de una manera diferente. Dados un conjunto de descripciones en base a atributos de ciertas entidades, un lenguaje de descripci´ on para caracterizar clases de estas entidades y un criterio de calidad de clasificaci´ on; el problema consiste en particionar las entidades en clases de tal manera que se maximice el criterio de calidad de clasificaci´ on y, simult´ aneamente, en determinar descripciones generales de estas clases en el lenguaje de descripci´ on dado. Por ello, un m´etodo de clustering conceptual busca no s´ olo una clasificaci´ on de las entidades, sino tambi´en una descripci´ on simb´ olica de las clases propuestas (clusters). Un aspecto importante que distingue al clustering conceptual es que, a diferencia del an´ alisis de clusters cl´ asico, las propiedades de las descripciones de clases se toman en consideraci´ on en el proceso de determinaci´ on de las clases. Para clarificar la diferencia entre el clustering conceptual y el clustering tradicional, n´ otese que un m´etodo de clustering convencional t´ıpicamente determina clusters en base a una medida de similaridad, que es una funci´ on definida u ´nicamente utilizando las propiedades (valores de los atributos) de las entidades que est´ an siendo comparadas: Similaridad(A, B) = f (propiedades(A), propiedades(B))

(2.14)

2.3. CLUSTERING

35

donde A y B son entidades a ser comparadas. En contraste con esta metodolog´ıa, las t´ecnicas de clustering conceptual agrupan entidades en base a la cohesi´ on de conceptos, la cual es una funci´ on no s´ olo de las propiedades (valores de los atributos), sino tambi´en de otros dos factores: el lenguaje de descripci´ on L, usado por el sistema para describir las clases de entidades, y el entorno E, el cual es el conjunto de ejemplos vecinos: Cohesi´ onConceptual(A, B) = f (propiedades(A), propiedades(B), L, E) (2.15) 

A



















B 

Figura 2.2: Diferencia entre cercan´ıa y cohesi´ on conceptual Por tanto, dos objetos pueden ser similares, es decir, cercanos de acuerdo a una cierta medida de distancia (o similaridad), pero pueden tener una baja cohesividad conceptual, y viceversa. Un ejemplo de la primera situaci´ on se puede ver en la Figura 2.2. Los puntos negros A y B son “cercanos” entre s´ı y, por ello, ser´ıan ubicados en el mismo cluster por cualquier t´ecnica basada u ´nicamente en las distancias entre los puntos. Sin embargo, estos puntos tienen una cohesividad conceptual peque˜ na debido a que pertenecen a configuraciones que representan diferentes conceptos. Si se dispone de un lenguaje de descripci´ on apropiado, un m´etodo de clustering conceptual permitir´ a agrupar los puntos de la Figura 2.2 en dos “elipses”, como lo har´ıa la mayor´ıa de las personas. Un criterio de calidad de clasificaci´ on utilizado en clustering conceptual puede involucrar una variedad de factores, tales como el ajuste de la descripci´ on de un cluster a los datos, la simplicidad de una descripci´ on u otras propiedades de las entidades o conceptos que los describen.

2.3.2.

Descubrimiento de subgrupos

La extracci´ on de modelos para la toma de decisiones a partir de conjuntos de datos en un proceso b´ asico en la miner´ıa de datos [66]. Los modelos, dependiendo del dominio al cual se deseen aplicar, podr´ an ser o bien predictivos o bien descriptivos. En los modelos predictivos, el objetivo principal es la capacidad

36

CAP´ITULO 2. PRELIMINARES

de clasificaci´ on del modelo as´ı como su interpretabilidad, mientras que en los descriptivos se busca encontrar relaciones o patrones de comportamiento. Como hemos visto en la Secci´ on 2.1, existen tres tipos de modelos; de caja blanca, de caja negra y de caja gris, en funci´ on de su interpretabilidad. Una clase de modelos descriptivos son los generados para el descubrimiento de subgrupos, donde se pretende obtener modelos descriptivos empleando mecanismos predictivos. Los modelos descriptivos habitualmente est´ an destinados al aprendizaje de reglas de asociaci´ on [2]. El aprendizaje de reglas de asociaci´ on es un mecanismo de inducci´ on descriptiva que se dedica a descubrir reglas individuales que definen patrones interesantes en los datos. Por otro lado, se puede definir el descubrimiento de subgrupos como un tipo de modelo descriptivo que se sit´ ua en la intersecci´ on entre la inducci´ on predictiva y descriptiva. Fue formulado inicialmente por Kl¨osgen, con su propuesta de aprendizaje de reglas EXPLORA, y Wrobel con MIDOS [57, 83]. En ellos, el problema del descubrimiento de subgrupos se define de la siguiente forma: “Dada una poblaci´ on de individuos y una propiedad de esos individuos en la que estamos interesados, buscar subgrupos en esa poblaci´ on que sean estad´ısticamente “m´ as interesantes”, siendo tan grandes como sea posible y ofreciendo el mayor valor de atipicidad estad´ıstica con respecto a la propiedad en la que estamos interesados”. En el descubrimiento de subgrupos, las reglas son de la forma Cond → Clase, donde la propiedad de inter´es es el valor de la clase que aparece en el consecuente de la regla. El antecedente de la regla estar´ a compuesto por una conjunci´ on de caracter´ısticas (pares atributo-valor) seleccionadas de entre las caracter´ısticas que definen las instancias de entrenamiento. Dado que las reglas se han obtenido a partir de prototipos de entrenamiento etiquetados, el proceso de descubrimiento de grupos se centra en encontrar las propiedades de un conjunto determinado de individuos de la poblaci´ on que satisfacen la propiedad de inter´es dada. El descubrimiento de subgrupos se puede considerar como un mecanismo de inducci´ on descriptiva que persigue encontrar patrones interesantes en los datos. Debido a esta circunstancia, algunas consideraciones est´ andar llevadas a cabo por los algoritmos de clasificaci´ on basados en reglas, tales como el que “las reglas inducidas deben presentar tanta precisi´ on como sea posible” o que “las reglas deben ser tan diferentes como sea posible, para cubrir diferentes porciones de la poblaci´ on”, deben de ser relajadas. En el descubrimiento de subgrupos, el objetivo es encontrar reglas individuales o patrones de inter´es, los cuales deben ofrecerse en una representaci´ on simb´ olica adecuada de tal forma que puedan ser utilizados con efectividad por potenciales usuarios de esa informaci´ on. La interpretabilidad de las reglas es por tanto un factor clave en el descubrimiento de subgrupos.

2.3. CLUSTERING

37

´ Esta es la raz´ on por la que a menudo se considera diferente el descubrimiento de subgrupos de las tareas propias de clasificaci´ on. El descubrimiento de subgrupos se centra en encontrar subgrupos de poblaci´ on interesantes en vez de maximizar la precisi´ on del conjunto de reglas inducido. Para evaluar el ´exito en descubrimiento de subgrupos, se estudiar´ an medidas descriptivas sobre el inter´es de cada regla obtenida. Las medidas de calidad propuestas consistir´ an en el valor medio del conjunto de reglas obtenido, lo cual nos permite comparar diferentes algoritmos.

2.3.3.

Estado del Arte

A continuaci´ on, se explicar´ a el funcionamiento de dos m´etodos para el descubrimiento de subgrupos –APRIORI y SUBDUE–, los cuales ser´ an utilizados en los pr´ oximos cap´ıtulos. 2.3.3.1.

APRIORI

El algoritmo APRIORI [1] consiste en un proceso sencillo de dos etapas: generar y combinar. La primera etapa genera conjuntos de elementos (itemsets) m´ as frecuentes de tama˜ no k y luego, durante la segunda etapa, se combinan para generar itemsets de tama˜ no k + 1. Solamente luego de explorar todas las posibilidades de asociaci´ on conteniendo k elementos, se consideran aquellos conjuntos de k + 1 elementos. El pseudoc´ odigo del algoritmo APRIORI se muestra en el Algoritmo 2.2. Algoritmo 2.2 APRIORI APRIORI (D base de datos) 1: L1 ← {1-itemsets m´ as frecuentes} 2: k ← 2 3: repetir 4: Ck ← k-itemsets generados a partir de Lk−1 5: para todo t ∈ D hacer 6: Incrementar el contador de todos los candidatos de C k que est´en cubiertos por t 7: fin para 8: Lk ← Todos los candidatos de Ck con soporte m´ınimo 9: k ←k+1 10: hasta Lk−1 = ∅ 2.3.3.2.

SUBDUE

El algoritmo SUBDUE [54] se basa en la extracci´ on de subestructuras en bases de datos estructuradas con atributos con valores discretos que pueden

CAP´ITULO 2. PRELIMINARES

38

ser representadas mediante grafos. Esta representaci´ on basada en grafos incluye etiquetas de nodos y ejes, tanto dirigidos como no dirigidos, donde los objetos y valores de atributos se hacen corresponder con v´ertices, y los atributos y las relaciones entre los objetos con ejes. Algoritmo 2.3 SUBDUE SUBDUE (grafo G, int Beam, int Limit) 1: Encolar Q ← (v|v tiene una etiqueta u ´nica en G) 2: bestSub ← primera subestructura en G 3: repetir 4: newQ ← () 5: para todo S in Q hacer 6: newSubs ← S extendida por un eje adyacente de G de todas las posibles maneras 7: newQ ← newQ ∪ newSubs 8: Limit ← Limit − 1 9: fin para 10: Evaluar subestructuras en newQ por compresi´ on de G 11: Q ← subestructuras en newQ con valores m´ aximos en Beam 12: si mejor subestructura en Q mejor que bestSub entonces 13: bestSub ← mejor subestructura en Q 14: fin si 15: hasta Q es vac´ıo o ´ Limit = 0 16: Devolver bestSub SUBDUE utiliza una variante del beam search [71] para su algoritmo de b´ usqueda principal. El objetivo de la b´ usqueda es encontrar la subestructura que mejor comprime el grafo de entrada. Para este fin, se usa el principio de longitud de descripci´ on m´ınima (MDL) [66] para evaluar las subestructuras. Una vez que la b´ usqueda termina y devuelve la lista de mejores subestructuras, el grafo puede ser comprimido utilizando la mejor de todas. El procedimiento de compresi´ on reemplaza todas las instancias de la subestructura en el grafo de entrada por un u ´nico nodo, el cual representa la subestructura. Los ejes entrantes y salientes de la subestructura reemplazada entrar´ an o saldr´ an del nuevo nodo que la representa. De acuerdo a la heur´ıstica MDL, la mejor subestructura es la que minimiza la longitud de descripci´ on del grafo una vez comprimido por la subestructura. La compresi´ on se calcula como: compresi´ on =

DL(S) + DL(G|S) DL(G)

(2.16)

donde DL(G) es el tama˜ no de la descripci´ on del grafo de entrada, DL(S) es el tama˜ no de la descripci´ on de la subestructura, y DL(G|S) es la tama˜ no de

2.3. CLUSTERING

39

la descripci´ on del grafo de entrada comprimido por la subestructura. SUBDUE implementa el principio MDL en el contexto de la compresi´ on de grafos, es decir, buscando aquella subestructura que minimice ese principio. En este contexto, la mejor subestructura en un grafo es aquella que minimiza DL(S) + DL(G|S) [25]. El tama˜ no de la descripci´ on de un grafo est´ a basada en la representaci´ on de su matriz de adyacencia, contando el n´ umero de bits necesarios para almacenar los nodos y sus etiquetas, los ejes y sus etiquetas, y su matriz de adyacencia. La descripci´ on detallada de este c´ alculo se puede consultar en [54]. El algoritmo de b´ usqueda intenta maximizar el valor de la subestructura, el cual es simplemente la inversa de la compresi´ on. Al comparar dos subestructuras diferentes del mismo repositorio, DL(G) es la misma para ambas. De este modo, la medida resultante es una combinaci´ on lineal de DL(S), esto es, el tama˜ no de la subestructura, y DL(G|S), esto es, el tama˜ no de la base de datos comprimida. Este u ´ltimo depende del n´ umero de apariciones de la subestructura S en la base de datos y del tama˜ no de S en s´ı misma.

2.3.4.

Clustering generalizado

Las t´ecnicas de clasificaci´ on matem´ atica han recibido mucha atenci´ on en el pasado como una de las grandes clases de procesos automatizables capaces de producir descripciones de caracter´ısticas estructurales de un conjunto de ejemplos desde un conjunto de descripciones conocidas de sus componentes. El descubrimiento de estructuras, las cuales no son sencillas de identificar a simple vista tras un examen cuidadoso de los datos, es de gran importancia para la comprensi´ on de las relaciones que controlan el comportamiento de sistemas, tales como las series econ´ omicas-financieras, las mol´eculas biol´ ogicas o las secuencias de ADN. Sin embargo, diferentes factores han limitado la utilidad de estos procedimientos de clasificaci´ on. Por un lado, la aplicaci´ on de un concepto de clasificaci´ on a un problema espec´ıfico lleva a obtener diferentes resultados de acuerdo al procedimiento de optimizaci´ on usado, sin extraer la informaci´ on subyacente de similaridad que los objetos de este problema poseen. Por otro lado, la mayor´ıa de los procedimientos propuestos intentan clasificar puntos en conjuntos sobre la base de una medida de similaridad entre estos puntos. En la mayor´ıa de las aplicaciones pr´ acticas, no se logra obtener los resultados deseados de esta forma sin el uso de otras herramientas para relajar la medida de semejanza o los requisitos de clasificaci´ on [81]. A diferencia de las t´ecnicas de clustering cl´ asicas, el clustering generalizado no se basa en la interpretaci´ on de los clusters como subconjuntos de un conjunto de datos, es decir, en el hecho que cada par de puntos en el subconjunto est´e cercano o sea “similar” en base a nociones predefinidas de distancia o similaridad. Al contrario, busca, en forma general, subconjuntos cohesivos en el sentido

40

CAP´ITULO 2. PRELIMINARES

de que los subconjuntos como un todo, exhiban ciertas relaciones y satisfagan ciertas restricciones especificadas en una colecci´ on de modelos dados. Para ello, identifica buenos clusters aislados en lugar de un buen clustering global. Enfatizaremos este proceso de clasificaci´ on como un proceso de identificaci´ on de atributos cualitativos en el sentido de que la similaridad no estar´ a considerada solamente entre puntos, sino tambi´en entre estructuras de un conjunto de datos y un modelo parametrizado derivado de una generalizaci´ on de un concepto protot´ıpico. El proceso de clustering, simplemente considerado como la optimizaci´ on de un funcional, puede llegar a obtener una colecci´ on de clusters precisos con una pobre generalizaci´ on. Por lo tanto, cualquier metodolog´ıa exitosa debe tambi´en considerar criterios adicionales basados en el tama˜ no de las subestructuras a ser explicadas.

2.4.

Algoritmos evolutivos

La Computaci´ on Evolutiva (CE) se basa en el empleo de modelos de procesos evolutivos para el dise˜ no e implementaci´ on de sistemas de resoluci´ on de problemas. Los distintos modelos computacionales que se han propuesto dentro de esta filosof´ıa suelen recibir el nombre gen´erico de Algoritmos Evolutivos (AEs) [11]. Existen cuatro tipos de AEs bien definidos que han servido como base a la mayor´ıa del trabajo desarrollado en el a´rea: los Algoritmos Gen´eticos (AGs), las Estrategias de Evoluci´ on (EEs), la Programaci´ on Evolutiva (PE) y la Programaci´ on Gen´etica (PG). Un AE se basa en mantener una poblaci´ on de posibles soluciones del problema a resolver, llevar a cabo una serie de alteraciones sobre las mismas y efectuar una selecci´ on para determinar cu´ ales permanecen en generaciones futuras y cu´ ales son eliminadas. Aunque todos los modelos existentes siguen esta estructura general, existen algunas diferencias en cuanto al modo de ponerla en pr´ actica. Los AGs se basan en operadores que tratan de modelar los operadores gen´eticos existentes en la naturaleza, como el cruce y la mutaci´ on, los cuales son aplicados a los individuos que codifican las posibles soluciones. En cambio, las EEs y la PE aplican transformaciones basadas en mutaciones efectuadas sobre los padres para obtener los hijos, lo que permite mantener una l´ınea general de comportamiento del individuo en su descendencia. Finalmente, la PG codifica las soluciones al problema en forma de programas, habitualmente codificados en una estructura de a´rbol, y adapta dichas estructuras empleando operadores muy espec´ıficos. Cada individuo de la poblaci´ on recibe un valor de una medida de adaptaci´ on que representa su grado de adecuaci´ on al entorno. La selecci´ on hace uso de estos valores y se centra en los individuos que presentan mayor valor en la media. Los operadores de recombinaci´ on y/o mutaci´ on alteran la composici´ on de dichos individuos, guiando heur´ısticamente la b´ usqueda a trav´es del espacio. Aunque simples desde un punto de vista biol´ ogico, este tipo de algoritmos son

2.4. ALGORITMOS EVOLUTIVOS

41

suficientemente complejos para proporcionar mecanismos de b´ usqueda adaptativos muy robustos. Los mismos procedimientos pueden ser aplicados a problemas de distintos tipos, sin necesidad de hacer muchos cambios [42]. En las siguientes secciones, se explicar´ an con m´ as detalle dos de estos tipos de AEs, los AGs y la PG, que ser´ an los utilizados en este trabajo.

2.4.1.

Algoritmos gen´ eticos

Los AGs [42] son una t´ecnica metaheur´ıstica para la soluci´ on de problemas de optimizaci´ on. Una metaheur´ıstica es un proceso iterativo que gu´ıa a una heur´ıstica subordinada combinando inteligentemente diferentes conceptos para explorar y explotar el espacio de b´ usqueda, usando estrategias de aprendizaje para estructurar la informaci´ on con el objetivo de encontrar eficientemente soluciones cercanas al o´ptimo [68]. Los AGs se basan en una analog´ıa de la teor´ıa biol´ ogica de la evoluci´ on de las especies y toman esta idea para buscar una o m´ as soluciones o´ptimas entre un conjunto de posibles soluciones. La Teor´ıa de la Evoluci´ on explica el origen y la transformaci´ on de los seres vivos como el producto de la acci´ on de dos principios fundamentales: la selecci´ on natural y el azar. La selecci´ on natural regula la variabilidad de la recombinaci´ on y mutaci´ on aleatorias de los genes: toda la variedad que observamos en la naturaleza se basa en la capacidad de los seres vivos de producir copias de s´ı mismos, en que el proceso de reproducci´ on actualiza muchas variantes, y en que, en la interacci´ on con el ambiente, algunas de ellas son seleccionadas para sobrevivir y producir las copias subsiguientes [31]. En lugar de buscar de general a espec´ıfico o de simple a complejo, los AGs generan descendientes de soluciones realizando repetidas mutaciones y cruces de las mejores soluciones de un conjunto. A cada paso, una colecci´ on de soluciones es actualizada reemplazando una fracci´ on de la poblaci´ on por la descendencia de las soluciones m´ as adaptadas al medio. Entonces se puede ver que estas soluciones ser´ an las que tendr´ an mayor probabilidad de pasar a la pr´ oxima generaci´ on. Para poder mostrar el algoritmo propuesto y explicar como funcionan, en general, los AGs es necesario primero comprender la terminolog´ıa utilizada. En las Figuras 2.3, 2.4 y 2.5 se pueden ver los conceptos en forma gr´ afica tomando como ejemplo el problema de encontrar el n´ umero m´ aximo entre 1 y 15 usando una representaci´ on binaria.

CAP´ITULO 2. PRELIMINARES

42 Cromosoma 1: Cromosoma 2: Cromosoma 3: Cromosoma 4: Cromosoma 5: .. .

0 0 0 0 0

0 0 0 1 1

0 1 1 0 0

1 0 1 0 1

Cromosoma N: 1 1 1 1 Figura 2.3: Poblaci´ on Poblaci´ on. Se denomina poblaci´ on al conjunto de individuos que representan las soluciones a optimizar. Cromosoma - Gen. Se denomina cromosoma a cada individuo de la poblaci´ on. A su vez, se conoce con el nombre de gen a cada parte del cromosoma que tiene significado por s´ı misma. Genotipo - Fenotipo. En la naturaleza, un genotipo es la informaci´ on gen´etica que, al desarrollarse, crea un fenotipo o ser vivo. En el a´mbito de los AGs, se denomina genotipo al conjunto de par´ ametros representado por un cromosoma particular que contiene toda la informaci´ on necesaria para construir una soluci´ on (organismo), a la cual se la denomina fenotipo. Cromosoma:

0 1 0 1

Genotipo: Fenotipo:

0 1 0 1 5

Gen

Figura 2.4: Genotipo vs. Fenotipo Generaci´ on. Se denomina generaci´ on a cada iteraci´ on del algoritmo.

2.4.2.

Algoritmo gen´ etico b´ asico

Los AGs exploran un espacio de soluciones candidatas en busca de la mejor soluci´ on. Cuando decimos la mejor soluci´ on, nos referimos a aquella que optimice una cierta funci´ on relevante para el problema tratado, a la que se conoce con el nombre de funci´ on de fitness o funci´ on de aptitud. A pesar que existen clases muy diversas de AGs, todas mantienen una estructura en com´ un: En cada iteraci´ on, todos los miembros de la poblaci´ on se eval´ uan de acuerdo a la funci´ on de fitness. Se genera una nueva poblaci´ on seleccionando de forma probabil´ıstica los mejores individuos de la

2.4. ALGORITMOS EVOLUTIVOS Generaci´ on 1 0 0 0 0 0

0 0 0 1 1

0 1 1 0 0

1 0 1 0 1

43

Generaci´ on 2 0 1 1 0 1

1 1 0 0 1

0 0 0 1 0

1 1 1 0 1

.. .

.. .

0 0 0 1

0 1 0 1

···

Generaci´ on M

··· ··· ··· ··· ··· .. .

1 1 1 1 1

···

1 1 1 1

1 1 1 1 1

1 1 1 1 1

1 1 1 1 1

.. .

Figura 2.5: Generaciones poblaci´ on actual. Algunos de estos individuos pasan a la pr´ oxima generaci´ on autom´ aticamente, mientras que otros se utilizan para procrear nuevas soluciones por medio de cruces de dos individuos, o bien se mutan antes de pasar a la pr´ oxima generaci´ on. ´ El algoritmo itera hasta cumplir con un criterio de parada. Este puede ser la cantidad de generaciones o evaluaciones de la funci´ on de fitness realizadas o la obtenci´ on de una soluci´ on que est´e dentro de un cierto umbral de aceptaci´ on. El pseudoc´ odigo del algoritmo b´ asico para un algoritmo gen´etico simple se muestra en la Figura 2.4 [42]. 2.4.2.1.

Representaci´ on de los cromosomas

La representaci´ on de los cromosomas depende del problema a tratar e influye directamente sobre los resultados del AG. Existen distintos esquemas generales de codificaci´ on entre los que destacan los siguientes: 1. La codificaci´ on binaria: Es la m´ as antigua de todas las existentes. La representaci´ on de los cromosomas est´ a definida como cadenas de bits de modo que, dependiendo del problema, cada gen puede estar formado por una subcadena de uno o varios bits. 2. La codificaci´ on real: La codificaci´ on binaria presenta algunos inconvenientes cuando se trabaja con problemas que incluyen variables definidas sobre dominios continuos: excesiva longitud de los cromosomas, falta de precisi´ on, etc. Una posible manera de evitar estos inconvenientes es considerar un esquema de representaci´ on real. Aqu´ı, cada variable del problema se asocia a un u ´nico gen que toma un valor real dentro del intervalo especificado, por lo que no existen diferencias entre el genotipo y el fenotipo.

CAP´ITULO 2. PRELIMINARES

44

Algoritmo 2.4 Pseudoc´ odigo para un AG b´ asico. entrada: f funci´ on de fitness, fumbral criterio de terminaci´ on, p tama˜ no de una poblaci´ on, pc probabilidad de cruce, pm probabilidad de mutaci´ on salida: individuo con mayor f 1: 2: 3: 4: 5: 6: 7: 8: 9: 10: 11: 12: 13: 14: 15:

P ← Generar p individuos al azar para todo h ∈ P hacer Calcular f (h) fin para mientras ([m´ axh f (h)] < fumbral ) hacer PS ← ∅ Seleccionar probabil´ısticamente (1 − r)p miembros de P para agregar a PS Seleccionar con probabilidad pc pares de individuos y producir descendencia aplicando el operador de cruce y agregarlos a P S Seleccionar con probabilidad pm individuos de PS . Para cada uno utilizar el operador de mutaci´ on y agregar el individuo modificado a P S P ← PS para todo h ∈ P hacer Calcular f (h) fin para fin mientras Retornar individuo con mayor f

3. La codificaci´ on basada en orden: Este esquema est´ a dise˜ nado espec´ıficamente para problemas de optimizaci´ on combinatoria en los que las soluciones son permutaciones de un conjunto de elementos determinando. Estos ejemplos de posibles representaciones nos dan una idea gen´erica del tipo de esquemas que se utilizan m´ as com´ unmente. Esto no implica que sean los u ´nicos, o que no se puedan crear esquemas propios, que no tengan relaci´ on alguna con los comentados, si es que se adaptan mejor a un problema en particular. 2.4.2.2.

Mecanismo de Selecci´ on

El mecanismo de selecci´ on es el encargado de seleccionar la poblaci´ on intermedia de individuos la cual, una vez aplicados los operadores de cruce y mutaci´ on, formar´ a la nueva poblaci´ on del AG en la siguiente generaci´ on. De este modo, el mecanismo de selecci´ on se encarga de obtener una poblaci´ on intermedia formada por copias de los cromosomas de la poblaci´ on original como

2.4. ALGORITMOS EVOLUTIVOS

45

se muestra en la Figura 2.6. Dos son los m´etodos de selecci´ on m´ as comunes: La Ruleta. Consiste en crear una ruleta en la que cada cromosoma tiene asignada una fracci´ on proporcional a su aptitud. Esta ruleta se gira varias veces para determinar qu´e individuos se seleccionar´ an. Debido a que a los individuos m´ as aptos se les asign´ o un a´rea mayor de la ruleta, se espera que sean seleccionados m´ as veces que los menos aptos. El torneo. La selecci´ on por torneo se ha popularizado debido a que s´ olo utiliza informaci´ on local para elegir a los mejores candidatos, por tanto reduciendo la complejidad de c´ alculo en poblaciones de gran tama˜ no. El torneo consiste en seleccionar un conjunto de individuos de la poblaci´ on al azar, dependiendo del tama˜ no del torneo, para luego comparar entre s´ı dichos individuos y elegir aqu´el con mejor valor de aptitud. Este proceso se realiza tantas veces como elementos existan en la poblaci´ on. En el caso de un torneo binario, la competencia se realiza entre dos individuos, seleccionando aqu´el con mejor funci´ on de aptitud. Evaluaci´ on 1 12 1 2 6 1

Poblaci´ on vieja

Poblaci´ on seleccionada

Figura 2.6: Ejemplo de aplicaci´ on del mecanismo de selecci´ on

2.4.2.3.

Operadores gen´ eticos

El operador de cruce constituye un mecanismo para compartir informaci´ on entre cromosomas. Combina las caracter´ısticas de dos cromosomas padre para obtener dos descendientes, con la posibilidad de que los cromosomas hijo, obtenidos mediante la recombinaci´ on de sus padres, est´en mejor adaptados que ´estos. No suele aplicase a todas las parejas de cromosomas de la poblaci´ on intermedia, sino que se lleva a cabo una selecci´ on aleatoria en funci´ on de una determinada probabilidad de aplicaci´ on, la probabilidad de cruce, p c . El operador de cruce cumple un papel fundamental en el AG. Su tarea consiste en explotar el espacio de b´ usqueda combinando las soluciones obtenidas hasta el momento mediante la recombinaci´ on de las buenas caracter´ısticas que presenten.

CAP´ITULO 2. PRELIMINARES

46

Un ejemplo del cruce m´ as conocido, llamado cruce simple en un punto, se muestra de forma gr´ afica en la Figura 2.7. El cruce simple se basa en seleccionar aleatoriamente un punto de cruce e intercambiar el c´ odigo gen´etico de los cromosomas padre a partir de dicho punto para formar los dos hijos.

Figura 2.7: Ejemplo de aplicaci´ on del operador de cruce simple de un punto La mutaci´ on, en cambio, pretende explorar el espacio de b´ usqueda alterando una de las componentes del c´ odigo gen´etico de un individuo. La mutaci´ on altera localmente el genotipo esperando obtener un individuo mejor. Debido al efecto de la selecci´ on, se sabe que s´ olo ser´ an elegidas las buenas soluciones para pasar a la pr´ oxima generaci´ on, mientras que las malas soluciones ser´ an eliminadas.

2.4.3.

Algoritmos gen´ eticos para funciones multimodales: Nichos

Como el nombre sugiere, las funciones multimodales tienen m´ ultiples soluciones o´ptimas, de las cuales varias pueden ser o´ptimos locales. Como ya hemos comentado, los AGs son conocidos por su capacidad para llevar a cabo procesos de b´ usqueda en espacios complejos. A pesar de ello, un AG cl´ asico puede no trabajar de modo adecuado cuando el espacio de b´ usqueda es multimodal y presenta varios o´ptimos locales. En estos casos, los AGs simples se caracterizan por converger hacia la zona del espacio donde se encuentran los mejores o´ptimos locales, abandonando la b´ usqueda en las zonas restantes (proceso conocido con el nombre de “deriva gen´etica”) [42]. Se han propuesto varios m´etodos para tratamiento de funciones multimodales en AGs. Veremos a continuaci´ on algunos de ellos: Diversidad a trav´ es de la mutaci´ on. Encontrar soluciones cercanas a diferentes soluciones o´ptimas en una poblaci´ on y mantenerlas por varias generaciones son dos temas diferentes. En las etapas iniciales del AG, las soluciones est´ an distribuidas por todo el espacio de b´ usqueda. Las soluciones cercanas a los m´ ultiples o´ptimos se enfatizan en las primeras generaciones. Eventualmente, cuando la poblaci´ on contiene buenos clusters de soluciones cercanas a los o´ptimos, comienza la competencia entre los diferentes o´ptimos. Este proceso competitivo contin´ ua hasta que la poblaci´ on converge a un solo o´ptimo. Para lograr mantener las soluciones encontradas en las primeras generaciones, es necesario un operador expl´ıcito de

2.4. ALGORITMOS EVOLUTIVOS

47

preservaci´ on de diversidad. El operador de mutaci´ on se utiliza, usualmente, con esa funci´ on. Este operador tiene una funci´ on tanto constructiva como destructiva. Debido a esto, se suele utilizar una baja probabilidad de mutaci´ on. Esto produce que sea insuficiente como u ´nico operador de preservaci´ on de diversidad. Preselecci´ on. En [20], se utiliza un mecanismo conocido como preselecci´ on. El concepto principal de este operador es reemplazar con un individuo parecido. Cuando se genera un hijo a partir de dos soluciones padre, se compara autom´ aticamente con ambos progenitores. Si el hijo est´ a mejor adaptado que el peor de sus padres, entonces reemplaza al padre. Como un hijo suele ser similar a sus padres, el reemplazo permite que diferentes soluciones co-existan en la poblaci´ on, manteniendo de esta forma la diversidad. Modelo de Crowding. En [32] se desarroll´ o este m´etodo para introducir diversidad en la poblaci´ on de un AG. En este esquema, se emplea una poblaci´ on solapada donde los individuos reemplazan a aquellos individuos de la poblaci´ on original de acuerdo a su similaridad. Un individuo se compara con una subpoblaci´ on de miembros de la poblaci´ on solapada determinada al azar. El individuo con la mayor similaridad es reemplazado por este nuevo individuo. Sin embargo, la forma m´ as habitual de dise˜ nar AGs multimodales se basa en los conceptos de nicho y especie. Ambos conceptos fueron introducidos con objeto de mantener m´ ultiples o´ptimos. Una de las formas m´ as habituales para provocar la formaci´ on de especies y la creaci´ on de nichos se basa en el esquema de sharing o proporci´ on [43]. El proceso de sharing permite mantener en la poblaci´ on de cada generaci´ on una cantidad proporcional de individuos en distintas zonas del espacio de b´ usqueda, manteniendo de esta manera una buena diversidad de soluciones. Cada zona del espacio de b´ usqueda estar´ a representado en el algoritmo como un nicho. En cada una se encontrar´ a un conjunto de soluciones cercanas de acuerdo a una cierta distancia. Estas subpoblaciones crean nichos en dos espacios posibles: el genot´ıpico y el fenot´ıpico. Al primero se lo conoce tambi´en con el nombre de espacio de variables. Adem´ as del espacio de variables, existe tambi´en el espacio de objetivos. Este espacio est´ a determinado por los objetivos del problema a optimizar. Para medir distancias en un espacio o en el otro, utilizaremos medidas diferentes, las que resulten m´ as adecuadas al espacio y al problema. Como ocurre en la naturaleza, los individuos de cada nicho comparten la recompensa asociada a dicho nicho entre ellos. Para esta tarea se define una funci´ on conocida como fitness sharing (funci´ on de proporci´ on). Este m´etodo permite distribuir la poblaci´ on sobre diferentes picos (m´ aximos o m´ınimos locales dependiendo del tipo de funci´ on de aptitud utilizada) del espacio de b´ usqueda,

CAP´ITULO 2. PRELIMINARES

48

donde la cantidad de individuos que recae en cada pico es proporcional a la calidad del pico si se trata de optimizar una funci´ on. Entonces, la selecci´ on de individuos debe permitir que elementos pertenecientes a distintos nichos sean mantenidos en las futuras generaciones. Para poder hacerlo, se genera un torneo. Dos individuos compiten entre s´ı para determinar cual de los dos pasar´ a a la pr´ oxima generaci´ on. Para decidir cual de los dos competidores ser´ a el ganador, se calcula la cantidad de elementos que existen en los nichos a los cuales pertenecen. La cantidad de elementos en cada nicho se define como: nicho(xi ) =

X

sh(d(xi , xj ))

(2.17)

xj ∈P

donde d es la medida de distancia entre dos elementos, P es el conjunto de individuos de la poblaci´ on y sh es la funci´ on de sharing. Esta funci´ on se define por lo general como: sh(v) =



1 − v/σshare 0

v ≤ σshare v > σshare

(2.18)

En este caso, σshare es el radio del nicho que debe ser especificado por el usuario y determina la m´ınima separaci´ on deseada entre picos. La funci´ on de proporci´ on (funci´ on de fitness modificada) sobre un individuo x i se define entonces como f (xi )/nicho(xi ), donde f es el valor de su funci´ on de fitness. Este proceso permite evitar que toda la poblaci´ on converja a una u ´nica soluci´ on y, en lugar de ello, permite que los individuos de cada nicho converjan independientemente. Es deseable obtener nichos igualmente poblados en las distintas generaciones de forma tal que: f (xi ) nicho(xi )

2.4.4.

=

f (xj ) nicho(xj )

∀xi , xj

individuos

(2.19)

Elitismo

El ciclo de nacimiento y muerte de los individuos est´ a muy relacionado con el manejo de la poblaci´ on. El tiempo de vida de un individuo es t´ıpicamente de una generaci´ on, aunque en algunos AGs puede ser mayor. La estrategia de elitismo relaciona la vida de los individuos con su aptitud. Estas estrategias son t´ecnicas utilizadas para mantener las buenas soluciones m´ as de una generaci´ on. Una estrategia de elitismo habitualmente utilizada en AGs es mantener una copia del mejor individuo encontrado hasta el momento en cada generaci´ on. Esto se realiza porque en el cruce los padres suelen ser reemplazados por sus hijos y, por ello, no hay seguridad de que los individuos con mayor aptitud sobrevivan a la pr´ oxima generaci´ on.

2.4. ALGORITMOS EVOLUTIVOS

2.4.5.

49

Programaci´ on gen´ etica

La programaci´ on gen´etica (PG) [59] es una t´ecnica que permite a los ordenadores resolver problemas sin ser expl´ıcitamente programados. Trabaja utilizando AGs para generar autom´ aticamente programas de ordenador. As´ı, en la PG, los individuos de una poblaci´ on son programas de ordenador. Para facilitar el proceso de creaci´ on de nuevos programas a partir de dos programas padre, los programas se escriben habitualmente como a´rboles de expresi´ on. Los nuevos programas se producen mediante la eliminaci´ on de ramas de un a´rbol y su inserci´ on en las de otro. Este proceso simple, conocido como cruce, asegura que los nuevos programas sean tambi´en a´rboles y, por lo tanto, sint´ actimente v´ alidos (ver Figura 2.8). Por ello, la PG es fundamentalmente diferente de simplemente mezclar l´ıneas de c´ odigo de m´ aquina. + +

* X

+

Padres

X

* –

X X

Hijo

X

* X

X

X

X

+ +

* X

X

X

* X

X

Figura 2.8: x2 + (x + (x − x)) cruzado con 2x2 para producir 2x2 + x La secuencia de operaciones en la PG viene dada en la Figura 2.9. Como puede observarse, es b´ asicamente la misma empleada en otros AGs. El operador de mutaci´ on no se utiliza generalmente en PG, ya que en la mayor´ıa de los casos no es necesaria [61]. La PG ha demostrado su potencial mediante la evoluci´ on de programas en un amplio rango de aplicaciones, incluyendo clasificaci´ on o recuperaci´ on de texto

CAP´ITULO 2. PRELIMINARES

50

Poblaci´ on de programas

Seleccionar padres en proporci´ on a la aptitud

Programas de test

/

/

Crear nuevos programas +

X

+

X

*

X

X

*

X

X

X

X

*

X

X

Figura 2.9: Ciclo de PG [64, 37], reconocimiento de caracteres o´pticos [7], clasificaci´ on de prote´ınas [46], procesamiento de im´ agenes [30], etc. Las estructuras de datos son conceptos claves en la programaci´ on de ordenadores, puesto que proveen de un mecanismo para agrupar datos que l´ ogicamente deber´ıan estar juntos y permiten manipular estos datos como una unidad l´ ogica. El tipado de datos (el cual se considera en muchos lenguajes de programaci´ on, incluyendo C++, Ada, Pascal y LISP, entre otros) es una forma de asociar un tipo (o clase) con cada instancia de una estructura de datos, permitiendo as´ı al c´ odigo manejar cada estructura de datos de manera diferente bas´ andose en su tipo. Incluso estructuras de datos con la misma estructura f´ısica subyacente, pueden tener tipos l´ ogicos diferentes. Por ejemplo, una matriz de 2×3, un vector de 6 elementos, y un vector de 3 n´ umeros complejos, seguramente tendr´ an la misma representaci´ on f´ısica pero tendr´ an diferentes tipos de datos. Diferentes lenguajes de programaci´ on utilizan el tipado de datos de forma distinta. Los lenguajes fuertemente tipados, tales como Ada y Pascal, utilizan los tipos de datos en tiempo de generaci´ on de programa para asegurarse que las funciones solo recibir´ an como argumentos los tipos de datos particulares que est´ an esperando. Los lenguajes tipados din´ amicamente, tales como LISP, utilizan los tipos de datos en tiempo de ejecuci´ on para permitir a los programas manejar los datos

2.5. PROBLEMAS MO Y AGMO

51

de forma diferente seg´ un sus tipos. La PG cl´ asica no est´ a dise˜ nada para manejar mezclas de tipos de datos. De hecho, una de sus asunciones es la de “clausura”, la cual indica que un s´ımbolo no-terminal deber´ıa poder manejar cualquier tipo de dato y valor devuelto por un terminal o no-terminal. Mientras que la clausura no prohibe el uso de m´ ultiples tipos de datos, forzar un problema que utiliza m´ ultiples tipos de datos a la restricci´ on de clausura puede afectar negativamente al rendimiento de un algoritmo de PG aplicado al mismo de forma severa e innecesaria. Una manera de solucionar la restricci´ on de clausura es definir los terminales y no-terminales del problema de manera cuidadosa para que no introduzcan tipos de datos m´ ultiples. Sin embargo, esta t´ecnica est´ a limitada en su aplicabilidad. Por ejemplo, los problemas que manipulan matrices o vectores, o aquellos que trabajan con listas, no pueden solucionarse de esta manera. Una forma de, simult´ aneamente, forzar clausura y permitir m´ ultiples tipos de datos es a trav´es del tipado din´ amico. Con esta idea, cada no-terminal deber´ a poder manejar como argumentos cualquier tipo de datos que pueda ser devuelto por cualquier terminal y no-terminal. Existen dos maneras (no necesariamente excluyentes) de realizar esto. La primera es tener una funci´ on que realice diferentes acciones con diferentes tipos de datos. La segunda es tener funciones que se˜ nalen un error cuando los argumentos sean de tipo inconsistente y asignen una aptitud infinitamente mala al a´rbol. Esto es esencialmente lo que se realiza con “estructuras sint´ acticas restringidas” [59].

2.5.

Problemas multiobjetivo y algoritmos gen´ eticos multiobjetivo

Una diferencia notable entre los m´etodos de b´ usqueda y optimizaci´ on cl´ asicos y los AGs es que, en estos u ´ltimos, se procesa una poblaci´ on de soluciones en cada iteraci´ on. Esta caracter´ıstica, por s´ı sola, le da a los AGs una tremenda ventaja para su uso en problemas de optimizaci´ on con m´ ultiples objetivos. Existen, al menos, dos dificultades asociadas a los m´etodos cl´ asicos de resoluci´ on de estos problemas: Para obtener varias soluciones de la frontera del Pareto con un m´etodo cl´ asico de optimizaci´ on, es necesario ejecutarlo varias veces, comenzando cada vez de una soluci´ on inicial diferente. Sin embargo, las diferentes ejecuciones de los m´etodos cl´ asicos sobre distintas soluciones iniciales no garantizan encontrar diferentes soluciones o´ptimas. Este escenario s´ olo ocurre si la soluci´ on inicial elegida es atra´ıda siempre por el o´ptimo. En las siguientes secciones se describir´ a la optimizaci´ on multiobjetivo, conjuntamente con los enfoques cl´ asicos para se resoluci´ on, se explicar´ a el funciona-

CAP´ITULO 2. PRELIMINARES

52

miento de AGMO muy utilizando, el NSGA-II [34], y, finalmente, se introducir´ an las m´etricas cl´ asicas para medir la bondad de las soluciones obtenidas mediante AGMOs.

2.5.1.

Optimizaci´ on multiobjetivo

Muchos problemas reales se caracterizan por la existencia de m´ ultiples medidas de actuaci´ on, las cuales deber´ıan ser optimizadas, o al menos ser satisfechas, simult´ aneamente. Como el propio nombre sugiere, el problema de la optimizaci´ on multiobjetivo consiste en el proceso de optimizaci´ on simult´ anea de m´ as de una funci´ on objetivo [23]. La falta de metodolog´ıas para resolver este tipo de problemas llev´ o a que, en un principio, se resolvieran como problemas mono-objetivo. Sin embargo, no es correcto tomar esta determinaci´ on ya que existen diferencias entre los principios en que se basan los algoritmos que tratan un solo objetivo y los que trabajan con varios. De esta forma, al trabajar con problemas mono-objetivo nos enfrentamos con la b´ usqueda de una soluci´ on que optimice esa u ´nica funci´ on objetivo, tarea distinta a la que se nos plantea al trabajar con problemas multiobjetivo. En este u ´ltimo caso, no pretendemos encontrar una soluci´ on o´ptima que se corresponda a cada una de las funciones objetivo, sino varias soluciones que satisfagan todos los objetivos a la vez de la mejor manera posible. Como en un problema de optimizaci´ on con un solo objetivo, tambi´en suele existir un n´ umero de restricciones que debe satisfacer cualquier soluci´ on factible. La forma general de un problema de optimizaci´ on multiobjetivo es la siguiente [33]: Definici´ on 1. Un problema de optimizaci´ on multiobjetivo se define como la maximizaci´ on/minimizaci´ on de f~ sabiendo que: fm (x), gj (x) ≥ 0, hk (x) = 0, (L) (U ) xi ≤ x i ≤ x i ,

m = 1, 2, . . . , M ; j = 1, 2, . . . , J; k = 1, 2, . . . , K; i = 1, 2, . . . , N.

donde M corresponde al n´ umero de objetivos que tiene el problema, J al n´ umero de restricciones de desigualdad, K al n´ umero de restricciones de igualdad, y, finalmente, N al n´ umero de variables de decisi´ on. Una soluci´ on x es un vector de N variables de decisi´ on: x = (x1 , x2 , . . . , xn )T . El u ´ltimo conjunto de la Ecuaci´ on 2.5.1 restringe cada variable de decisi´ on xi a (L) (U ) tomar un valor en el intervalo [xi , xi ]. Si alguna soluci´ on x satisface todas las restricciones y los l´ımites de las variables se la conoce como soluci´ on factible. La mayor´ıa de los algoritmos de optimizaci´ on multiobjetivo usan el concepto de dominancia es su b´ usqueda del o´ptimo. A continuaci´ on describimos con detalle este concepto [33]. En los algoritmos de optimizaci´ on multiobjetivo, la

2.5. PROBLEMAS MO Y AGMO

53

preferencia entre dos soluciones se especifica en funci´ on de que una domine a la otra. Definici´ on 2. Se dice que una soluci´ on x domina a otra soluci´ on y (x ≺ y)cuando se cumplen las siguientes condiciones: La soluci´ on x no es peor que y en todos los objetivos: fi (x) 7 fi (y) para todo i = 1, 2, . . . , M . La soluci´ on x es estrictamente mejor que y en, al menos, un objetivo: fj (x) / fj (y) para al menos un i ∈ {1, 2, . . . , M }. Si alguna de las condiciones anteriores es violada, la soluci´ on x no domina a la soluci´ on y. Si x domina a la soluci´ on y tambi´en es com´ un escribir que x es no dominada por y.

f2 (minimizar) 5 3 2 1

2 

4 

1

5





3 

8 9

11 12

16 f1 (maximizar)

Figura 2.10: Dominancia entre soluciones. Supongamos el problema con dos funciones objetivo representado en la Figura 2.10: la primera de las funciones f1 ser´ a una funci´ on a maximizar, mientras que f2 ser´ a una funci´ on a minimizar. Considerando la optimizaci´ on conjunta de las dos funciones objetivo, es dif´ıcil encontrar una soluci´ on que sea la mejor respecto a ambas. Utilizando la definici´ on de dominancia podremos decidir qu´e soluci´ on es la mejor de dos soluciones dadas en t´erminos de ambos objetivos. Por ejemplo: si comparamos las soluciones 1 y 2, observamos que la soluci´ on 1 es mejor que la 2 en las dos funciones objetivo f1 y f2 . Esto supone que se cumplen las dos condiciones de dominancia, luego podremos afirmar que la soluci´ on 1 domina a la soluci´ on 2. De forma intuitiva podemos decir que si una soluci´ on x domina a otra y, entonces x es mejor que y para la optimizaci´ on multiobjetivo. El concepto de dominancia proporciona una forma de comparar soluciones con m´ ultiples objetivos. Como ya hemos comentado, la mayor´ıa de los m´etodos

54

CAP´ITULO 2. PRELIMINARES

de optimizaci´ on multiobjetivo usan este concepto para buscar soluciones no dominadas. Si, en el ejemplo que mostramos antes, comparamos la soluci´ on 3 con la 5, observamos que la soluci´ on 5 es mejor que la soluci´ on 3 en el objetivo f 1 mientras que es peor en el segundo objetivo, f2 . Vemos que la primera condici´ on no se cumple para ambas soluciones, lo que simplemente nos dice que no podemos concluir que la soluci´ on 5 domine a la soluci´ on 3 ni tampoco que la 3 domine a la 5. Cuando esto ocurre, es costumbre decir que las soluciones 3 y 5 son no dominadas una respecto de la otra. Teniendo en cuenta ambos objetivos, no podemos decidir cu´ al de las dos soluciones es la mejor. Para un conjunto de soluciones dado, podemos realizar todas las posibles comparaciones de pares de soluciones y encontrar cu´ ales dominan a cu´ ales y qu´e soluciones son no dominadas con respecto a las otras. Al final esperamos conseguir un conjunto de soluciones tales que cualesquiera dos no dominen una a la otra, es decir, un conjunto en el que todas las soluciones son no dominadas entre s´ı. Este conjunto se conoce como conjunto de soluciones no dominadas. Este conjunto tambi´en tiene otra propiedad: dada cualquiera soluci´ on que no pertenezca a ´el, siempre podremos encontrar una soluci´ on del conjunto que la domine. As´ı, este conjunto particular tiene la propiedad de dominar a todas las soluciones que no pertenecen al mismo. En t´erminos simples, esto significa que las soluciones de este conjunto son mejores comparadas con el resto de soluciones. Una dificultad com´ un en la optimizaci´ on multiobjetivo es la aparici´ on de un conflicto entre objetivos [47], es decir, el hecho de que ninguna de las soluciones factibles sea o´ptima simult´ aneamente para todos los objetivos. En este caso, la soluci´ on matem´ atica m´ as adecuada es quedarse con aquellas soluciones que ofrezcan el menor conflicto posible entre objetivos. Estas soluciones pueden verse como puntos en el espacio de b´ usqueda que est´ an colocados de forma o´ptima a partir de los o´ptimos individuales de cada objetivo, aunque puede que dichas soluciones no satisfagan las preferencias del experto que quiera establecer algunas prioridades asociadas a los objetivos. Para encontrar tales puntos, todas las t´ecnicas cl´ asicas reducen el vector objetivo a un escalar, es decir, a un u ´nico objetivo. En estos casos, en realidad, se trabaja con un problema sustituto buscando una soluci´ on sujeta a las restricciones especificadas. A continuaci´ on, vamos a repasar tres de las t´ecnicas cl´ asicas m´ as comunes para afrontar problemas con m´ ultiples objetivos. Posteriormente, dedicaremos una secci´ on a analizar los inconvenientes que presentan. ´ Optimizaci´ on Mediante Ponderaci´ on de los Objetivos. Esta es probablemente la m´ as simple de todas las t´ecnicas cl´ asicas. En este caso, las funciones objetivo se combinan en una funci´ on objetivo global, F , de la siguiente manera [41]:

2.5. PROBLEMAS MO Y AGMO

F (x) =

55

M X

wi fi (x)

(2.20)

∀wi ∈ , 0 ≤ wi ≤ 1

(2.21)

i=1

donde los pesos wi se definen como: F (x) =

M X

wi = 1 ;

i=1



En este m´etodo, la soluci´ on o´ptima se controla mediante un vector de pesos w de forma que la preferencia de un objetivo puede cambiarse modificando dichos pesos. En muchos casos, primero se optimiza cada objetivo individualmente y despu´es se calcula el valor de la funci´ on objetivo completa para cada uno de ellos. As´ı podemos conseguir evaluar la importancia que ejerce cada objetivo y encontrar un vector de pesos adecuado. Despu´es, la soluci´ on final aceptada se calcula optimizando F seg´ un los pesos establecidos. Las u ´nicas ventajas de usar esta t´ecnica es que se puede potenciar a un objetivo frente a otro y que la soluci´ on obtenida es normalmente Pareto-optimal. Optimizaci´ on Mediante Funciones de Distancia. Con esta t´ecnica, la reducci´ on a un escalar se lleva a cabo usando un vector de nivel de demanda, y¯, que debe especificar el experto. Por esta raz´ on, suele denominarse “programaci´ on por metas” (goal programming) [21]. En este caso, la funci´ on F se obtiene por medio de la siguiente f´ ormula: F =

M X i=1

fi (x) − y¯ir

! r1

;

1≤r≤∞

(2.22)

Normalmente, se elige una m´etrica Eucl´ıdea r = 2, considerando y¯ como o´ptimos de los objetivos individuales. Es importante recalcar que la soluci´ on obtenida depende enormemente del vector de nivel de demanda establecido, de modo que si ´este es malo, no se llegar´ a a una soluci´ on Pareto-optimal. Como la soluci´ on no est´ a garantizada, el experto debe tener un conocimiento profundo de los o´ptimos individuales de cada objetivo para establecer adecuadamente y¯. De esta forma, el m´etodo busca la meta indicada (representada por y¯) para cada objetivo. Esta t´ecnica es similar a la anterior. La u ´nica diferencia es que ahora se requiere saber la meta de cada objetivo mientras que en el enfoque de ponderaci´ on era necesario conocer su importancia relativa. Optimizaci´ on Mediante Formulaci´ on Min-Max. Esta t´ecnica intenta minimizar las desviaciones relativas de cada funci´ on objetivo a partir de o´ptimos individuales, esto es, intenta minimizar el conflicto entre objetivos [69]. El problema Min-Max se define como: Minimizar f (x) = max[Zj (x)] ; j = 1, . . . , M

CAP´ITULO 2. PRELIMINARES

56

donde Zj (x) se define para el valor o´ptimo positivo f¯j > 0 como: Zj (x) =

|fj − f¯j | f¯j

;

j = 1, . . . , M

(2.23)

Esta t´ecnica puede obtener la mejor soluci´ on cuando los objetivos a optimizar tienen igual prioridad. Sin embargo, la prioridad de cada objetivo puede alterarse utilizando pesos en la f´ ormula. Tambi´en es posible introducir un vector de nivel de demanda. Inconvenientes de las T´ecnicas Cl´ asicas. Todas las t´ecnicas cl´ asicas que se han utilizado para resolver problemas multiobjetivo tienen graves inconvenientes que han dado lugar a que no sean adecuadas en muchas ocasiones. A continuaci´ on, mencionamos los m´ as significativos: Dado que los distintos objetivos se combinan para formar uno u ´nico, s´ olo podremos obtener una soluci´ on Pareto-optimal simult´ aneamente. En situaciones reales, los expertos necesitan con frecuencia varias alternativas para decidir, pero estas t´ecnicas no pueden ofrecerlas. Adem´ as, para realizar esta combinaci´ on, muchas veces es necesario tener un conocimiento sobre el problema que generalmente es dif´ıcil de obtener. No funcionan bien cuando los objetivos no son fiables o tienen un espacio de variables discontinuas. Si las funciones objetivo no son determin´ısticas, la elecci´ on de un vector de pesos o de niveles de demanda entra˜ na gran dificultad. Son muy sensibles y dependientes de los pesos o niveles de demanda usados. Para solucionar estos problemas, han surgido t´ecnicas avanzadas de optimizaci´ on multiobjetivo basadas en Enfriamiento Simulado [15, 62], AGs [33, 22], EEs [60], etc. En concreto, los AEs multiobjetivo han demostrado un muy buen comportamiento.

2.5.2.

Estado del arte: NSGA-II

El algoritmo NSGA-II [34] es una versi´ on mejorada del nondominated sorting genetic algorithm (NSGA). La idea subyacente al algoritmo NSGA [86] es la utilizaci´ on de un m´etodo de selecci´ on basado en ranking para enfatizar las buenas soluciones y un m´etodo de nichos para una buena diversidad de soluciones en las sub-poblaciones. El algoritmo NSGA trabaja como un AG cl´ asico con algunos pasos adicionales para poder obtener un frente de Pareto diverso (ver Figura 2.11). Antes de

2.5. PROBLEMAS MO Y AGMO

57 Inicio

Inicializar poblacion gen = 0

frente = 1

¿esta clasificada la poblacion?

No

identificar individuos no dominados

Si reproduccion segun la dummy fitness

realizar sharing en el frente actual

cruce

mutacion

gen = gen + 1

Si

asignar dummy fitness

frente = frente + 1

¿es gen < maxgen?

No Parar

Figura 2.11: Diagrama de flujo del algoritmo NSGA la etapa de selecci´ on, se ordena la poblaci´ on en base a la no dominancia de cada individuo. Se asigna entonces un valor de aptitud dummy suficientemente alto a todas las soluciones no dominadas para darle igual potencial reproductivo a todas ellas. Con el fin de mantener la diversidad de la poblaci´ on, el valor de aptitud de estos individuos se calcula proporcionalmente al n´ umero de individuos a los que domina. Este procedimiento se conoce como sharing (ver Secci´ on 2.4.3). Luego del sharing, se ignora temporalmente a los individuos no dominados para as´ı procesar al resto de la poblaci´ on de la misma manera. Los individuos resultantes conformar´ an el segundo frente de Pareto. A este nuevo conjunto de soluciones se les asigna un nuevo valor dummy de aptitud, el cual se mantiene estrictamente menor que el m´ınimo valor de aptitud del frente de Pareto previo. Este proceso contin´ ua con el resto de la poblaci´ on hasta clasificar a todos los individuos en varios frentes de Pareto. La poblaci´ on es entonces seleccionada de acuerdo a sus valores de fitness dummy, para luego aplicarles los operadores gen´eticos de la misma manera que

CAP´ITULO 2. PRELIMINARES

58

en un AG cl´ asico. Dado que los individuos que se encuentran en el primer frente tienen el valor de fitness m´ aximo, ser´ an siempre los que obtengan un mayor n´ umero de copias que el resto de la poblaci´ on, resultando en una r´ apida convergencia de la poblaci´ on hacia las regiones no dominadas mientras que el sharing ayuda a distribuirlas uniformemente en esta regi´ on. El algoritmo NSGA tiene algunos problemas que la extensi´ on realizada por el NSGA-II intenta solucionar: Alta complejidad computacional en la determinaci´ on del orden de las soluciones no dominadas. Falta de elitismo. Necesidad de especificar los par´ ametros del sharing. El algoritmo NSGA-II incluye las modificaciones necesarias para superar estos problemas. Primero, se reduce la complejidad computacional reescribiendo el c´ odigo original de la ordenaci´ on de una manera m´ as eficiente, guardando los datos temporales en cada paso para su posterior reutilizaci´ on. Segundo, se agrega un procedimiento de elitismo que compara la poblaci´ on actual con la poblaci´ on anterior de las mejores soluciones no dominadas en cada generaci´ on del algoritmo. Finalmente, para evitar la necesidad de par´ ametros en el proceso cl´ asico de sharing, se utiliza un nuevo procedimiento de sharing. Para conseguir una estimaci´ on de la densidad de soluciones que rodean a una soluci´ on particular de la poblaci´ on, se calcula la distancia promedio de dos soluciones xb y xc a cada lado de esta soluci´ on en cada uno de los objetivos. Estos dos puntos se seleccionan de acuerdo al siguiente procedimiento. El c´ omputo de la distancia de crowding requiere reordenar la poblaci´ on de acuerdo a cada uno de los objetivos en orden descendente. Luego, para cada objetivo, se asigna a aquellas soluciones en los bordes (soluciones con un valor m´ aximo o m´ınimo) un valor de distancia infinito. Entonces, se asigna a todas las soluciones intermedias un valor de distancia igual a la diferencia absoluta normalizada de los valores en el objetivo en cuesti´ on de las dos soluciones adyacentes (las soluciones x b y xc ). El valor de distancia global de crowding se calcula finalmente como la suma de los valores de distancia individual correspondientes a cada objetivo. Cada funci´ on objetivo es normalizada antes de calcular el valor de distancia. Una soluci´ on con un valor de distancia menor est´ a, en alg´ un sentido, m´ as rodeada de otras soluciones. Luego de calcular el valor de distancia a cada soluci´ on de la poblaci´ on, podemos comparar dos soluciones seg´ un su grado de proximidad con otras soluciones. Gracias a ello, se define un operador de comparaci´ on de crowding ≺ c para guiar este proceso de selecci´ on: xi ≺c xj

si (xiorden < xjorden ) ∨ ((xiorden = xjorden ) ∧ (xidistancia > xjdistancia )) (2.24)

2.5. PROBLEMAS MO Y AGMO

59

donde xiorden (xjorden ) es el orden−´esimo frente donde la soluci´ on xi (xj ) est´ a ubicado, e xidistancia (xjdistancia ) es la distancia de crowding de xi (xj ). Esto significa que preferimos, entre dos soluciones con diferentes rangos de no dominancia, aquella con el rango m´ as bajo. Si ambas soluciones pertenecen al mismo frente, entonces preferiremos aquella soluci´ on que est´e ubicada en la regi´ on menos densa. El esquema general de funcionamiento del algoritmo NSGA-II se grafica en la Figura 2.12.

Figura 2.12: Esquema del algoritmo NSGA-II

2.5.3.

Evaluaci´ on de los resultados de un algoritmo gen´ etico multiobjetivo

Como venimos mencionado, los AEs multiobjetivo basados en el Pareto se caracterizan por devolver muchas soluciones distintas a un problema determinado con diferentes objetivos a cumplir, igualmente v´ alidas entre s´ı. Esto plantea la siguiente pregunta: ¿c´ omo podemos medir la calidad del algoritmo en lo que respecta a la generaci´ on de estas soluciones? Dedicaremos las dos subsecciones siguientes a describir la forma en que podemos responder esta pregunta. 2.5.3.1.

M´ etricas para la Medici´ on de la Calidad de los Paretos

En el caso de la optimizaci´ on multiobjetivo, la definici´ on de calidad es sustancialmente m´ as compleja que para la optimizaci´ on de problemas mono-objetivo, ya que la optimizaci´ on en s´ı implica varios objetivos. Un conjunto Pareto de soluciones no dominadas deber´ıa cumplir los siguientes requisitos: 1. Estar compuesto por un n´ umero alto de soluciones.

60

CAP´ITULO 2. PRELIMINARES 2. Estar compuesto por un n´ umero alto de soluciones distintas. 3. Minimizar la distancia existente con respecto al frente del Pareto o´ptimo para el problema en cuesti´ on (es decir, el conjunto real de soluciones de dicho problema, el cual es a veces desconocido). 4. Presentar una buena distribuci´ on de las soluciones que lo componen (en el mejor de los casos, una distribuci´ on uniforme). La evaluaci´ on de este criterio puede basarse en el uso de una m´etrica. 5. Maximizar la extensi´ on del frente no dominado (Pareto) obtenido, es decir, para cada objetivo, las soluciones no dominadas deben cubrir la mayor amplitud de valores posible.

En la literatura, podemos encontrar varios intentos para formalizar las definiciones anteriores (o partes de ellas) mediante m´etricas cuantitativas (v´ease [97]). Por ejemplo, los dos primeros criterios son sencillos de medir, basta con contar tanto el n´ umero de soluciones que componen el frente del Pareto derivado, como el n´ umero de soluciones distintas existentes entre ellas. En el contexto de las investigaciones sobre convergencia al frente del Pareto o´ptimo (criterio 3), varios autores han considerado la distancia del conjunto de soluciones no dominadas generado al Pareto o´ptimo [38], de la misma manera que la funci´ on M1 que introduciremos posteriormente. La distribuci´ on no se ten´ıa en cuenta, porque el inter´es no estaba en este aspecto. Sin embargo, en estudios comparativos, se ha visto que la distancia por s´ı sola no es suficiente para la evaluaci´ on de la calidad del Pareto y, consecuentemente, del comportamiento del algoritmo que lo deriv´ o, ya que frentes con distribuciones muy distintas pueden tener la misma distancia al frente del Pareto o´ptimo. De este modo, queda claro el hecho de que este criterio no es suficiente por s´ı solo y, adem´ as, presenta el problema de que es necesario conocer el frente real del Pareto para poder aplicarlo. En [98], Zitzler y Thiele presentaron dos m´etricas complementarias para evaluar la calidad de los conjuntos de soluciones no dominadas generados por AEs multiobjetivo basadas en los criterios 4 y 5 mostrados anteriormente. Por un lado, se tiene en cuenta la distribuci´ on de las soluciones no dominadas en el espacio genot´ıpico o en el espacio objetivo (m´etrica M 2 ). Por otro, se considera el tama˜ no del a´rea ocupada por dichas soluciones en el frente del Pareto (m´etrica M3 ). Pasamos a describir la composici´ on de las tres u ´ltimas m´etricas mencionadas. ¯ el frente del Pareto o´ptimo para el problema a resolver, X 0 el conjunto de Sean X soluciones no dominadas generado por el AE multiobjetivo, a y a ¯ dos soluciones pertenecientes respectivamente a los dos conjuntos anteriores, σ un par´ ametro de vecindad y k · kH una medida de distancia: La funci´ on M1 proporciona la distancia media al conjunto Pareto o´ptimo ¯ Como puede verse en la figura 2.13, las soluciones pueden estar en el X.

2.5. PROBLEMAS MO Y AGMO

61

Pareto o´ptimo o fuera de ´el. En el caso de estar dentro del frente o´ptimo del Pareto, su distancia al mismo ser´ a cero. En el caso de no estar dentro del Pareto o´ptimo, se calcula la distancia a la soluci´ on del Pareto m´ as cercana y se toma este valor como indicador de la calidad de esa soluci´ on: M1 (X 0 ) =

1 X ¯ min{ka0 − a ¯ kH ; a ¯ ∈ X} |X 0 | 0 0

(2.25)

a ∈X





Soluci´ on en el Pareto o´ptimo 





Soluci´ on fuera del Pareto o´ptimo 













Figura 2.13: Soluciones posibles L´ ogicamente, cuanto menor sea el valor de M1 , menor ser´ a la distancia existente entre ambos conjuntos de soluciones no dominadas y mejor ser´ a la calidad del Pareto derivado. La funci´ on M2 tiene en cuenta la distribuci´ on de las soluciones del conjunto Pareto derivado X 0 con respecto al n´ umero de soluciones no dominadas que lo componen (|X 0 |): M2 (X 0 ) =

X 1 |{a0 ∈ X 0 ; ka0 − b0 k > σ}| |X 0 − 1| 0 0

(2.26)

a ∈X

N´ otese como, para cada soluci´ on a0 del conjunto X 0 , se contabiliza cu´ antas de las soluciones restantes est´ an a una distancia mayor de σ de ella. Finalmente, se calcula el valor medio de la suma de la cuenta correspondiente a cada soluci´ on. De este modo, el valor de M2 est´ a definido en [0, |X 0 − 1|]

CAP´ITULO 2. PRELIMINARES

62

y el Pareto generado ser´ a tanto mejor cuanto mayor sea dicho valor para un par´ ametro de vecindad adecuado. Por ejemplo, el valor M 2 = |X 0 − 1| indica que, para cada soluci´ on del Pareto, no existe ninguna otra soluci´ on a una distancia menor de σ de ella. Por u ´ltimo, la distribuci´ on de las soluciones a lo largo del Pareto o´ptimo puede estar aglomerada en una sola zona del espacio de b´ usqueda como puede verse en la Figura 2.14, lo que no es deseable. Por ello, se calcula la funci´ on M3 que considera la extensi´ on del frente descrito por X 0 : v uM uX M3 (X 0 ) = t max{ka0i − b0i kH ; a0 , b0 ∈ X 0 }

(2.27)

i=1

Individuos algutinados en una sola zona del espacio















Figura 2.14: Soluciones aglutinadas en una zona del Pareto o´ptimo As´ı, M3 mide la distancia m´ axima en cada dimensi´ on para determinar el a´rea que ocupa el Pareto. Las m´etricas anteriores est´ an definidas en el espacio genot´ıpico, es decir, en el espacio de las soluciones al problema. An´ alogamente, existen tres m´etricas M∗1 , M∗2 y M∗3 definidas sobre el espacio objetivo, es decir, sobre el espacio de vectores de valores de los objetivos. Sean Y e Y 0 los conjuntos de los vectores objetivo que corresponden a X y X 0 , respectivamente; p y p0 vectores objetivo de dichos conjuntos, y σ ∗ > 0 y k · kH ∗ como antes, tenemos:

2.5. PROBLEMAS MO Y AGMO

M∗1 (Y 0 ) = M∗2 (Y 0 ) =

63

1 X min{kp0 − p¯kH ∗ ; p¯ ∈ Y¯ } |Y 0 | 0 0

(2.28)

p ∈Y

X 1 |{p0 ∈ Y 0 ; kp0 − q 0 k > σ ∗ }| |Y − 1| 0 0 0

(2.29)

p ∈Y

v uN uX ∗ 0 M3 (Y ) = t max{kp0i − qi0 kH ∗ ; p0 , q 0 ∈ Y 0 }

(2.30)

i=1

N´ otese que en el caso de problemas con dos objetivos, el valor de M 3 equivale a la distancia existente entre las dos soluciones m´ as extremas. Adicionalmente, se define la m´etrica S [96], que calcula el tama˜ no del espacio dominado por las soluciones de un conjunto Pareto: Sea A = (x1 , . . . , xl ) ⊆ X 0 un conjunto de l soluciones. La funci´ on S(A) devuelve el volumen cubierto por la uni´ on de los politopos p1 , . . . , pl , donde cada pi est´ a formado por la intersecci´ on de los siguientes hiperplanos que surgen desde xi siguiendo los ejes cartesianos: para cada eje en el espacio de objetivos, existe un hiperplano perpendicular al eje y que pasa a trav´es del punto (f 1 (xi ), . . . , fm (xi )). En el caso de dos dimensiones, cada pi representa un rect´ angulo definido por los puntos (0, 0) y (f1 (xi ), f2 (xi )). 2.5.3.2.

Calidad de las soluciones obtenidas entre algoritmos

Hasta el momento, las medidas propuestas verifican la correcci´ on de cada algoritmo en diversos atributos con respecto a la soluci´ on deseada. Si, en cambio, se desea hacer una comparaci´ on directa entre las diferentes versiones del mismo algoritmo o distintos algoritmos multiobjetivo, se debe realizar comparando ambas con el Pareto o´ptimo de por medio. Para realizar una comparaci´ on directa, se proponen dos ´ındices que permiten ver si un algoritmo es mejor que otro sin tener en cuenta su parecido o inclusi´ on en el Pareto o´ptimo. Antes de enunciar las medidas propuestas es necesario explicar la notaci´ on a utilizar, n´ otese que los objetivos a optimizar se est´ an maximizando: Se dice que b domina globalmente a (tambi´en escrito como a ≺ b) sii ∀i ∈ {1, . . . , n} : fi (a) ≤ fi (b) ∃j ∈ {1, . . . , n} : fj (a) < fj (b)



En el caso de tener solamente dos objetivos f1 y f2 la definici´ on dada se reduce a buscar que

CAP´ITULO 2. PRELIMINARES

64

f1 (a) ≤ f1 (b) ∧ f2 (a) ≤ f2 (b) f1 (a) < f1 (b) ∨ f2 (a) < f2 (b)



Adicionalmente, se dice que b cubre a (a  b) sii a ≺ b o f (a) = f (b). Se dice que b domina localmente a (tambi´en escrito como a C b) sii ∀i ∈ {1, . . . , n} : fi (a) ≤ fi (b) ∃j ∈ {1, . . . , n} : fj (a) < fj (b) ka − bk ≤ σ

∧ ∧

Si utilizamos dos objetivos, entonces la definici´ on dada se reduce a buscar que f1 (a) ≤ f1 (b) ∧ f2 (a) ≤ f2 (b) f1 (a) < f1 (b) ∨ f2 (a) < f2 (b) ka − bk ≤ σ

∧ ∧

Adicionalmente, se dice que b cubre localmente a (a E b) sii a C b o f (a) = f (b). La primera medida propuesta utiliza una funci´ on que mapea un par de soluciones (X1 ,X2 ) a un intervalo [0,1] [97]: C(X1 , X2 ) =

|{a2 ∈ X2 ; ∃a1 ∈ X1 : a1 E a2 | |X2 |

(2.31)

El valor extremo C(X1 , X2 ) = 1 significa que todas las soluciones en X2 est´ an dominadas o son iguales que las soluciones de X1 . El valor extremo C(X1 , X2 ) = 0, por su parte, representa la situaci´ on en la cual ninguna de las soluciones de X2 est´ a cubierta por el conjunto X1 . Es necesario notar que tanto C(X1 , X2 ) como C(X2 , X1 ) tienen que ser considerados ya que C(X1 , X2 ) 6= 1 − C(X2 , X1 ). La segunda medida propuesta utiliza una funci´ on que mapea un par de soluciones (X1 ,X2 ) a un intervalo [0,1] [78]: N D(X 0 , X 00 ) = |{a0 ∈ X 0 ∧ a0 ∈ / X 00 : (∀a00 ∈ X 00 : a00  a0 )}

(2.32)

La medida N D(X 0 , X 00 ) compara dos conjuntos de soluciones no dominadas y devuelve el n´ umero de soluciones de X 0 que no son iguales y no son dominadas por ning´ un miembro de X 00 . Una vez m´ as, ambas medidas, N D(X 0 , X 00 ) y N D(X 00 , X 0 ), deben ser tenidas en cuenta. Existe una diferencia clara entre las medidas N D y C: la u ´ltima muestra la relaci´ on de dominancia entre dos conjuntos de soluciones, mientras que la primera cuenta el n´ umero de soluciones novedosas, perteneciente al primer conjunto que no descubre el segundo.

Cap´ıtulo

3

Metodolog´ıa

L

a creciente disponibilidad de repositorios de datos biol´ ogicos, tales como bases de datos que contienen informaci´ on sobre interacciones prote´ınaprote´ına o caminos metab´ olicos, no ha sido secundada por el desarrollo de herramientas que permitan la extracci´ on de conocimiento de estos repositorios. Esta problem´ atica se ha renovado debido a las nuevas tendencias de acumulaci´ on de grandes cantidades de datos en bases de datos estructuradas, las cuales pueden verse como redes de informaci´ on cuyos nodos son los objetos del repositorio y cuyos ejes corresponden a las relaciones existentes entre estos objetos. Varias t´ecnicas de clustering conceptual se han aplicado para extraer subestructuras relevantes de estos datos estructurales. Sin embargo, los clusters m´ as relevantes generalmente difieren de los patrones m´ as frecuentes y, por ello, sigue siendo un reto. En este cap´ıtulo se propondr´ a una metodolog´ıa, llamada Clustering Conceptual basado en Evoluci´ on MultiObjetivo (CC-EMO), que identifica conceptos de clusters representados como subestructuras en bases de datos estructuradas mediante la optimizaci´ on conjunta de diferentes criterios.

3.1.

Problem´ atica

Durante las u ´ltimas d´ecadas, se ha estado acumulando conocimiento, proveniente de diferentes a´reas, en repositorios de datos digitales. Al estar almacenada de esta manera, la informaci´ on puede ser estudiada y compartida m´ as f´ acilmente por distintos expertos. A pesar de esto, el aumento constante del tama˜ no de estos repositorios hace casi imposible, para un ser humano, extraer informaci´ on u ´til de los mismos. Por esta raz´ on, se han desarrollado diversas t´ecnicas de miner´ıa de datos para poder revelar informaci´ on oculta en grandes colecciones de datos [45, 49] y as´ı poder ayudar a los usuarios. Estas t´ecnicas funcionan 65

CAP´ITULO 3. METODOLOG´IA

66

correctamente con representaciones de datos en forma atributo-valor, es decir, datos no estructurados. Sin embargo, muchos proyectos de adquisici´ on de datos actuales acumulan informaci´ on estructurada que describe no s´ olo los objetos de la base de datos, sino tambi´en las relaciones que existen entre ellos. Estos conjuntos de datos son estructurados en el sentido de que los objetos que almacenan est´ an descritos por las relaciones entre las caracter´ısticas y no solamente por las caracter´ısticas en s´ı mismas. Debido a ello, existe la necesidad de crear t´ecnicas que permitan analizar y descubrir conceptos definidos mediante subestructuras en repositorios de datos estructurados. Por otro lado, los algoritmos de clustering cl´ asicos se centran en la optimizaci´ on de un u ´nico criterio de preferencia. Com´ unmente, este criterio suele ser la combinaci´ on de dos o m´ as m´etricas que calculan la bondad de una configuraci´ on de clusters, como pueden ser: el n´ umero de clusters, la cantidad de elementos que cubre cada cluster, la cohesi´ on de los miembros de cada cluster, cu´ an disjuntos son los distintos clusters, etc. Sin embargo, se utilizan mayoritariamente dos criterios: la especificidad y la sensibilidad. La especificidad se calcula generalmente como el tama˜ no de la subestructura que define el concepto que reune a las instancias agrupadas en un cluster, mientras que la sensibilidad corresponde habitualmente al n´ umero de instancias que pertenece a un cluster. En la mayor´ıa de los casos, la especificidad y la sensibilidad de un cluster son objetivos que est´ an contrapuestos. Por ello, la mayor´ıa de las t´ecnicas de clustering actuales se enfocan en encontrar una buena soluci´ on de compromiso, es decir, un conjunto de clusters que sean aceptablemente buenos en ambos objetivos simult´ aneamente mediante la agregaci´ on de los mismos en un u ´nico criterio de preferencia. El enfoque cl´ asico de clustering presenta varios problemas importantes. Primero, no es natural encontrar en dominios de datos reales un conjunto de conceptos que definan diferentes clusters que subdividan los objetos de la base de datos en grupos completamente disjuntos. De hecho, es considerablemente m´ as probable tener objetos que pertenezcan a m´ as de un cluster a la vez. Segundo, no todos los elementos de un repositorio de datos tienen el mismo nivel de inter´es, es decir, algunas instancias pueden contener campos con valores desconocidos o estar expuestos a errores en su definici´ on que pueden representar outliers y, por lo tanto, no ser f´ acilmente agrupables con el resto de la base de datos. Al usuario final del proceso de clustering le ser´ an u ´tiles solamente aquellos conceptos que sean relevantes. Tercero, como hemos mencionado en la Secci´ on 2.5.1, la combinaci´ on de diferentes funciones de preferencia en un u ´nico criterio generalmente lleva a obtener resultados sub´ optimos.

3.2.

Propuesta

Para poder solucionar los problemas mencionados en la secci´ on anterior, nos basaremos en el hecho de que las medidas para extraer subestructuras interesan-

3.2. PROPUESTA

67

tes de una base de datos estructurada necesitan la consideraci´ on de diferentes aspectos y, por ende, trabajan en el campo de la optimizaci´ on multiobjetivo. Es por ello que proponemos una metodolog´ıa a la cual llamaremos Clustering Conceptual basado en Evoluci´ on MultiObjetivo (CC-EMO) que realiza clustering conceptual de las instancias de un repositorio de datos estructurado de un dominio dado, identificando patrones comunes representados por subestructuras, mediante el uso de t´ecnicas de optimizaci´ on multiobjetivo. Mediante el uso de un enfoque multiobjetivo, obtendremos el mejor conjunto de subestructuras que sean conjuntamente o´ptimas en especificidad y sensibilidad. Por lo tanto, dada una base de datos estructurada, el algoritmo CC-EMO propuesto en este trabajo generar´ a, en una sola ejecuci´ on, un conjunto Pareto de subestructuras de un repositorio dado. Este conjunto Pareto estar´ a compuesto de varias subestructuras que representar´ an diferentes conceptos, cada uno de ellos cubriendo un subconjunto de elementos de la base de datos. Para ello, cada cluster tiene un concepto inherente que agrupa un conjunto de instancias, las cuales est´ an determinadas por su sem´ antica. Las soluciones de este proceso de optimizaci´ on ser´ an: (1) aquellas subestructuras con un gran n´ umero de instancias cubiertas pero que pueden contener elementos que no sean altamente cohesivos, (2) aquellas subestructuras con una homogeneidad muy alta pero que representan una menor cantidad de instancias, y (3) todas las posibles subestructuras no dominadas con valores intermedios de ambos objetivos entre (1) y (2). Con este prop´ osito, haremos uso de los Algoritmos Evolutivos (AEs) [11], que han demostrado obtener buenos resultados en este campo [33, 22]. Algunos ejemplos de aplicaciones al aprendizaje autom´ atico y a la miner´ıa de datos utilizando AEs se pueden encontrar en [44, 39, 26].

3.2.1.

Metodolog´ıa general

La t´ecnica multiobjetivo descrita en los p´ arrafos anteriores constituye el coraz´ on de la metodolog´ıa que proponemos en este trabajo. Pero, para poder obtener buenos resultados, es necesario hacer uso de t´ecnicas de pre y post procesamiento que faciliten la b´ usqueda de las mejores soluciones. El flujo de informaci´ on en el que se basa nuestra metodolog´ıa se muestra en la Figura 3.1. La metodolog´ıa consta de cuatro etapas: Construcci´ on de la base de datos estructurada, Clustering conceptual multiobjetivo, Compactaci´ on la base de datos y Predicci´ on. Durante la primera fase se realiza el pre-procesamiento de la base de datos donde est´ a contenida la informaci´ on a ser estudiada. Mediante una transformaci´ on de estos datos en bruto en objetos estructurados, se genera un nuevo repositorio de datos. La transformaci´ on de cada elemento de la base de datos incluye no s´ olo los atributos de cada instancia, sino tambi´en las relaciones que ´estos tienen entre s´ı. Esta nueva base de objetos estructurados servir´ a de entrada al proceso central de la metodolog´ıa, el clustering conceptual

CAP´ITULO 3. METODOLOG´IA

68

Construcci´ on de la base de datos estructurada

Clustering Conceptual multiobjetivo

DATOS EN BRUTO

MODELADO DE LOS OBJETOS

OBJETIVOS

OBJETOS ESTRUCTURADOS

APRENDIZAJE DE MODELOS

CONTROL

Compactaci´ on de la BD

NUEVOS DATOS

MODELOS

Predicci´ on retroalimentaci´ on ´ PREDICCION

Figura 3.1: Esquema general de la metodolog´ıa CC-EMO

´ DE LA BASE DE DATOS ESTRUCTURADA 3.3. CONSTRUCCION

69

multiobjetivo. El agrupamiento de las instancias de la base de datos se realiza mediante la optimizaci´ on de diversos objetivos, los cuales son definiciones espec´ıficas de los dos criterios gen´ericos de especificidad y sensibilidad para cada problema en particular. Los conceptos aprendidos son aquellas soluciones que no est´ an dominadas entre s´ı. Esto quiere decir que los conceptos descubiertos no son peores que ning´ un otro del conjunto de soluciones en todos los objetivos. En otras palabras, las soluciones encontradas no son comparables entre s´ı, ya que si un concepto es mejor que otro en alg´ un objetivo, ser´ a, a su vez, peor en otro. Se genera entonces un conjunto Pareto de soluciones no dominadas, el cu´ al se depura luego en la etapa de compactaci´ on utilizando para ello una nueva base de datos de control. Esta nueva base de datos contiene informaci´ on externa e independiente de los mismos datos en bruto que han sido utilizados al comenzar el proceso. A la luz de estos datos, se seleccionan aquellos conceptos m´ as relevantes y se genera una nueva base de datos con estos conceptos para poder utilizarlos en la etapa de predicci´ on. En esta u ´ltima fase se realiza una clasificaci´ on de nuevos datos utilizando los conceptos generados por la metodolog´ıa. Al estudiar la clasificaci´ on realizada en el proceso de inferencia, es natural encontrar peque˜ nos fallos que pueden ser modificados en un proceso de retroalimentaci´ on y corregir no s´ olo el sistema de modelado de los datos, sino tambi´en los objetivos del algoritmo de clustering, para as´ı poder, en una nueva iteraci´ on, producir mejores predicciones. En las secciones siguientes se explicar´ a con m´ as detalle cada uno de estos pasos utilizando un dominio sencillo para ilustrarlos adecuadamente.

3.3.

Construcci´ on de la base de datos estructurada

Para poder comprender mejor el funcionamiento de la metodolog´ıa propuesta, utilizaremos un dominio de datos muy sencillo que nos permitir´ a ejemplificar cada paso de la misma. Hemos denominado geom´etrico al dominio empleado y es una simplificaci´ on del considerado en [54]. En este dominio se representan figuras geom´etricas y sus posiciones relativas en el espacio. En nuestra simplificaci´ on trabajaremos solamente con pilas de figuras geom´etricas. Nuestra base de datos de objetos en bruto consiste en instancias donde se representan pilas de figuras geom´etricas en forma lineal. Por ejemplo, tendremos una instancia “cuadrado - rect´ angulo” que representa una pila que contiene a un cuadrado sobre un rect´ angulo. Para poder trabajar de forma eficiente con los datos de este dominio, es necesario poder modelarlos de manera que se facilite su procesamiento. Cada instancia de la base de datos original se representa como un a´rbol en la base de objetos estructurados. El a´rbol est´ a compuesto por dos clases de nodos y dos clases de ejes. Los nodos pueden ser de dos tipos diferentes: nodos objeto o nodos figura. Los nodos figura pueden ser instanciados

CAP´ITULO 3. METODOLOG´IA

70

en: “tri´ angulo”, “cuadrado”, “elipse”, “rect´ angulo” o “c´ırculo”, mientras que los nodos objeto s´ olo pueden tener el valor “objeto”. Existen dos posibles relaciones en este dominio, representadas como ejes en los a´rboles: la relaci´ on “sobre” y la relaci´ on “forma”. La relaci´ on forma solamente puede ocurrir entre un nodo de tipo objeto y un nodo de tipo figura, mientras que la relaci´ on sobre s´ olo puede unir dos nodos de tipo objeto. Desde el punto de vista sem´ antico, la relaci´ on forma determina la propiedad visual del nodo objeto que est´ a conectado al nodo figura, mientras que la relaci´ on sobre determina las posiciones relativas de los objetos. Debido al hecho que s´ olo existen dos posibles relaciones, las instancias y las subestructuras se representan como a´rboles binarios. objeto forma

sobre

elipse

objeto figura c´ırculo

Figura 3.2: Ejemplo de instancia de la base de datos de objetos estructurados del dominio geom´etrico En la Figura 3.2 se puede ver un ejemplo de una instancia de la base de datos donde las diferentes formas de los nodos representan diferentes tipos de nodos y las diferentes etiquetas de los ejes muestran las diferentes relaciones. En esta figura se puede ver, a la izquierda, la subestructura que representa el concepto del cluster (genotipo) y, a la derecha, su sem´ antica (fenotipo). En este caso hay dos objetos, uno con forma circular y otro oval. La relaci´ on sobre los conecta determinando la posici´ on relativa en la pila de objetos. En este caso, el objeto con forma oval est´ a sobre el objeto de forma circular. Mediante esta representaci´ on se pueden llegar a generar posibles conceptos de clusters. En la Figura 3.3 se muestra una subestructura posible para el domino geom´etrico. Las cajas con signos de interrogaci´ on corresponden a objetos cuya relaci´ on forma no est´ a descrita y s´ olo las relaciones de posici´ on est´ an determinadas mediante ejes de tipo sobre. Esta subestructura representa el concepto que cubre a todas aquellas instancias con al menos tres figuras geom´etricas en la pila en las que haya un objeto de forma triangular con otro objeto sobre ´el y uno por debajo de ´el, cualquiera sea su forma. Este ejemplo simple muestra el poder de expresi´ on de las subestructuras que pueden ser descubiertas por nuestra metodolog´ıa utilizando una representaci´ on de datos adecuada y a la vez sencilla de interpretar por cualquier usuario. Un modelado incorrecto o demasiado espec´ıfico puede llegar a sesgar el espacio de b´ usqueda y, por lo tanto, proveer

3.4. CLUSTERING CONCEPTUAL MULTIOBJETIVO

71

objeto sobre

?

objeto figura

sobre

tri´ angulo

objeto

?

Figura 3.3: Ejemplo de subestructuras del dominio geom´etrico de informaci´ on de menor utilidad para el usuario final. Mediante este modelado de objetos, se construye una nueva base de datos constituida por estos objetos estructurados (en este caso, a´rboles) que permitir´ a al algoritmo principal poder inferir mejores conceptos de clusters.

3.4.

Clustering Conceptual multiobjetivo

El proceso de clustering por el cual se aprenden los conceptos de cada cluster constituye el coraz´ on de la metodolog´ıa. El clustering se realiza mediante una t´ecnica evolutiva de optimizaci´ on multiobjetivo que optimiza conjuntamente los objetivos espec´ıficos del problema. En el caso del dominio geom´etrico, se utilizar´ an dos objetivos cl´ asicos de clustering: especificidad y sensibilidad. La sensibilidad de un cluster se calcula, simplemente, como la cantidad de instancias que se encuentran agrupadas en el cluster dado. La especificidad hace referencia al tama˜ no de la subestructura que define el concepto del cluster. Como en el dominio geom´etrico la representaci´ on de los conceptos es en forma de a´rbol, el tama˜ no de la subestructura se calcula como el n´ umero de nodos sumado al n´ umero de ejes que posea. Por ejemplo, la subestructura de la Figura 3.3 tiene tama˜ no 7, ya que su genotipo consta de 4 nodos y 3 ejes. Las funciones objetivo, resumidas en las ecuaciones 3.1 y 3.2 y utilizadas en este ejemplo, son est´ andar y pueden considerarse en esta metodolog´ıa para cualquier dominio en el cual no se tenga mucho conocimiento. A partir de su aplicaci´ on a un conjunto de datos y a trav´es de la retroalimentaci´ on que ´este provea, se podr´ an ir depurando hasta conseguir un conjunto de objetivos espec´ıficos para el problema. A su vez, se puede ver que estos dos objetivos son claramente contrapuestos ya que, generalmente, a medida que el tama˜ no de la subestructura, aumenta la descripci´ on del cluster se hace m´ as espec´ıfica y ´este cubre una menor cantidad de elementos. Por lo tanto, es necesario obtener todas aquellas posibles soluciones de compromiso entre los dos objetivos utilizando el concepto de dominancia de Pareto introducido en la Secci´ on 2.5.1:

CAP´ITULO 3. METODOLOG´IA

72

Soporte(xsubestructura , BD) =

X  1 Cubre(xsubestructura , i) 0 sino

(3.1)

i∈BD

T ama˜ no(xsubestructura , BD) = T ama˜ no(xsubestructura )

(3.2)

Debido a que, en la mayor parte de los dominios reales, el espacio de b´ usqueda es sumamente grande, es necesario hacer uso de alguna heur´ıstica para acelerar la b´ usqueda. A continuaci´ on, se describir´ a el m´etodo llamado Clustering Conceptual basado en Evoluci´ on MultiObjetivo (CC-EMO) que realizar´ a la b´ usqueda en un tiempo razonable obteniendo los resultados deseados. Si bien los conceptos que se extraer´ an pueden no ser o´ptimos, el algoritmo heur´ıstico propuesto ha demostrado obtener buenas soluciones en los dominios experimentados. Inicio

Inicializar poblacion gen = 0

frente = 1

¿esta clasificada la poblacion?

No

identificar individuos no dominados

Si reproduccion segun la dummy fitness

realizar sharing en el frente actual

cruce

mutacion

gen = gen + 1

Si

asignar dummy fitness

frente = frente + 1

¿es gen < maxgen?

No Parar

Figura 3.4: Algoritmo CC-EMO La implementaci´ on actual del algoritmo CC-EMO est´ a basada en el algoritmo NSGA-II [34] descrito en la Secci´ on 2.5.2. Los pasos b´ asicos de CC-EMO se

3.4. CLUSTERING CONCEPTUAL MULTIOBJETIVO

73

muestran en el diagrama de flujo de la Figura 3.4 y sus componentes principales se describen a continuaci´ on: Representaci´ on de los cromosomas. El algoritmo CC-EMO utiliza una representaci´ on interna de cromosomas en forma de a´rbol, lo cual lo convierte en un algoritmo de Programaci´ on Gen´etica (PG) [59, 12] (ver Secci´ on 2.5.1). Los problemas a los cuales se les puede aplicar este algoritmo son aquellos que puedan ser representados en forma de grafos que no contengan ciclos. Como vimos en la Secci´ on 2.5.1, la PG es un AE basado en evolucionar programas codificados como estructuras tales como a´rboles de expresiones. La PG ha sido utilizada ampliamente para resolver varios problemas reales en diferentes dominios, tales como: modelado de sistemas no lineales [75], recuperaci´ on de informaci´ on [27, 28] y miner´ıa de datos [90], obteniendo buenos resultados. La codificaci´ on de un cromosoma est´ a compuesta de nodos, que representan las caracter´ısticas, y ejes que los conectan, los cuales representan relaciones entre las caracter´ısticas de una instancia de la base de datos. Cada nodo y eje que conforman un cromosoma tiene un nombre, el cual describe al nodo (su sem´ antica), y una etiqueta asociada que indica el tipo de nodo. Esta etiqueta ser´ a utilizada por los operadores gen´eticos, como veremos m´ as adelante.

(a) Padre 1

(b) Padre 2

(c) Hijo

Figura 3.5: Operaci´ on de cruce de un algoritmo de PG Operadores gen´eticos. Sobre los cromosomas que componen la poblaci´ on de un PG, se aplican los operadores de cruce y mutaci´ on. El operador de cruce utilizado es el est´ andar para PG, que consiste en el intercambio de dos sub´ arboles elegidos al azar de cada uno de los a´rboles padres, como se muestra en la Figura 3.5. Con el fin de producir un descendiente v´ alido, se impone una restricci´ on al operador de cruce: la ra´ız de ambos sub´ arboles debe tener la misma etiqueta. Reemplazando sub´ arboles con la misma etiqueta en su nodo ra´ız, se mantendr´ an las relaciones v´ alidas en el cromosoma descendiente final y, por lo tanto,

74

CAP´ITULO 3. METODOLOG´IA

se obtendr´ a un descendiente v´ alido. En el a´rea de PG, el uso de este tipo de cromosoma con restricciones se conoce como PG basada en tipos [59]. Los operadores de mutaci´ on utilizados son tambi´en cl´ asicos en PG: Borrado de una hoja, seleccionada aleatoriamente y eliminada conjuntamente con el eje que la conecta al a´rbol (ver Figura 3.6). Modificaci´ on de un nodo, seleccionado aleatoriamente y reemplazado por otro perteneciente al conjunto posible de nodos con la restricci´ on de tener la misma etiqueta (ver Figura 3.7). Agregaci´ on de una hoja, creada aleatoriamente y conectada al a´rbol por un nuevo eje (ver Figura 3.8). Optimizaci´ on multiobjetivo. Los objetivos que procura maximizar conjuntamente CC-EMO son, como ya hemos mencionado, especificidad y sensibilidad. Para el caso espec´ıfico del dominio geom´etrico, ambos objetivos se calculan como se muestra en las ecuaciones 3.1 y 3.2 utilizando las funciones Cubre y Tama˜ no definidas en las ecuaciones 3.3 y 3.4. Cubre(arbolA , arbolB ) = arbolA ⊆ arbolB T ama˜ no(arbolX ) = #nodos(arbolX ) + #ejes(arbolX )

(3.3) (3.4)

La funci´ on Cubre nos dice si un a´rbol dado (la subestructura que define un cluster) cubre a otro a´rbol (la representaci´ on de una instancia de la base de datos), comprobando si el primer a´rbol es un sub´ arbol del segundo. En la Figura 3.9 se muestra una subestructura y dos instancias cubiertas por la misma. En color celeste se ilustra en el genotipo la relaci´ on de inclusi´ on (⊆) entre la subestructura y la instancia. Relaci´ on de no dominancia. Es necesario hacer notar que dos conceptos con valores muy similares en sus objetivos, por ejemplo, el mismo tama˜ no de la subestructura y un soporte muy similar, pueden no describir el mismo grupo de instancias de la base de datos, como puede verse en la Figura 3.10. La dominancia cl´ asica excluir´ıa a uno de ellos, aqu´el con el menor n´ umero de instancias cubiertas, lo cual nos har´ıa perder clusters potencialmente interesantes. Debido a que estos conceptos no describen las mismas instancias, debemos mantener ambas soluciones y, por tanto, ser´ an necesarias ciertas restricciones para poder producir un conjunto Pareto sin perder subestructuras interesantes. ´ Esta es una problem´ atica cl´ asica de los problemas de optimizaci´ on multimodales, como ya se ha descrito en la Secci´ on 2.4.3. Para solucionarla, existen diversas t´ecnicas que evitan que, dadas dos soluciones o´ptimas locales pertenecientes a distintas zonas del espacio, una de ellas sea eliminada. En nuestra metodolog´ıa, utilizaremos una t´ecnica de nichos calculada en el espacio de instancias como se explicar´ a a continuaci´ on.

3.4. CLUSTERING CONCEPTUAL MULTIOBJETIVO

´ (a) Arbol original

´ (b) Arbol mutado

Figura 3.6: Mutaci´ on: borrado de una hoja

´ (a) Arbol original

(b) Nodos posibles

´ (c) Arbol mutado

Figura 3.7: Mutaci´ on: modificaci´ on de un nodo

´ (a) Arbol original

´ (b) Arbol mutado

Figura 3.8: Mutaci´ on: agregaci´ on una hoja

75

CAP´ITULO 3. METODOLOG´IA

76

objeto ?

sobre objeto figura

sobre

tri´ angulo

objeto

?

(a) Modelo

objeto forma

sobre

elipse

objeto figura

sobre

tri´ angulo

objeto figura c´ırculo (b) Instancia 1

objeto forma

sobre objeto

cuadrado figura

sobre

tri´ angulo

objeto figura

sobre

circulo

objeto figura cuadrado (c) Instancia 2

Figura 3.9: Ejemplos de cobertura de una subestructura (a) a dos instancias (b,c)

3.4. CLUSTERING CONCEPTUAL MULTIOBJETIVO O2

77

X2 









































O1

X1

Figura 3.10: Dos soluciones en el conjunto Pareto. A pesar de que a simple vista parece que una domina a otra, las dos soluciones pertenecen a dos espacios diferentes teniendo en cuenta las variables y no los objetivos.

La no dominancia entre soluciones se modificar´ a entonces para hacerla tener en cuenta las instancias cubiertas por cada concepto. Para ello, dos soluciones son comparadas por dominancia si y solo si tienen al menos un 50 % de instancias en com´ un, esto es, si el valor del Coeficiente de Jaccard [53] (ver ecuaci´ on 3.5, donde X e Y son los conjuntos de instancias cubiertas por cada soluci´ on) entre ellos es mayor que 0,5, si no, se dice que las soluciones son no dominadas.

jaccard(X, Y ) =

X ∩Y X ∪Y

(3.5)

Con esta restricci´ on, dos soluciones ser´ an comparadas u ´nicamente si la intersecci´ on de las instancias que cubren es mayor al 50 % de su soporte. Entonces, la dominancia de Pareto se reformula como:

ij

sii (jaccard(f2 (i), f2 (j)) > 0,5)∧ f1 (x) ≥ f1 (y) ∧ f2 (x) ≥ f2 (y) ∧ (f1 (x) > f1 (y) ∨ f2 (x) > f2 (y)) (3.6) donde f1 es la funci´ on objetivo que mide la cohesi´ on de un cluster y f 2 es la funci´ on objetivo que mide la cobertura del cluster.

78

3.5.

CAP´ITULO 3. METODOLOG´IA

Evaluaci´ on de los clusters generados

Con la finalidad de poder medir la bondad de los resultados obtenidos por nuestra metodolog´ıa, realizaremos una comparaci´ on con los resultados obtenidos utilizando otras t´ecnicas de clustering. La implementaci´ on ha sido codificada en R R Pentium el lenguaje Eiffel (ISE Eiffel v4.5) y ejecutada en un Intel 4 CPU 3,20GHz. En primer lugar, compararemos con los resultados obtenidos por el algoritmo APRIORI introducido en la Secci´ on 2.3.3.1, para luego compararlos con otra metodolog´ıa de descubrimiento de subgrupos en bases de datos estructuradas conocida como SUBDUE y explicada en la Secci´ on 2.3.3.2. En el caso del dominio geom´etrico, utilizaremos una base de datos de 100 instancias de pilas de figuras geom´etricas elegidas de forma aleatoria. La poblaci´ on inicial del algoritmo estar´ a compuesta por sub´ arboles seleccionados tambi´en de forma aleatoria de la base de datos. Los par´ ametros utilizados por los algoritmos para este dominio se muestran en la Tabla 3.1. El algoritmo CC-EMO se ha ejecutado diez veces con diferentes semillas y el promedio de estas ejecuciones es el que se muestra en adelante. Par´ ametro Tama˜ no de la poblaci´ on N´ umero de evaluaciones Probabilidad de cruce Probabilidad de mutaci´ on

Valor 100 10000 0,6 0,2

Tabla 3.1: Par´ ametros para dominio geom´etrico

El primer paso en la comparaci´ on consiste en ver de forma gr´ afica los resultados obtenidos. Para ello, graficamos el conjunto Pareto para cada uno de los enfoques utilizados (APRIORI, SUBDUE y CC-EMO) en el espacio de objetivos, como puede verse en la Figura 3.11. Para generar el conjunto Pareto correspondiente al APRIORI, se ha ejecutado este algoritmo y se han extra´ıdo las mejores primeras 100 soluciones (el tama˜ no de la poblaci´ on es igual para todos los enfoques y corresponde a lo indicado en la Tabla 3.1). A este conjunto de soluciones se les ha aplicado el criterio de no dominancia y extra´ıdo finalmente el conjunto Pareto. De forma similar se ha obtenido el conjunto Pareto para SUBDUE, pero el conjunto de 100 soluciones corresponde a la uni´ on de tres conjuntos de 33 elementos, cada uno asociado a las soluciones obtenidas optimizando el objetivo de tama˜ no de la subestructura, el n´ umero de instancias y el MDL, respectivamente. El conjunto Pareto para el CC-EMO est´ a compuesto de la uni´ on de las soluciones obtenidas por las diez ejecuciones del algoritmo. Es necesario recordar que, a pesar de que se han dibujado soluciones que a primera vista parecer´ıan estar dominadas por otras, el coeficiente de Jaccard entre las instancias cubiertas

1

1

0.8

0.8

0.8

0.6

0.6

+

0.4

SOPORTE

1

SOPORTE

SOPORTE

´ DE LOS CLUSTERS GENERADOS 3.5. EVALUACION

+

0.4

0.6

0.2

0.2

0

0

0

0.1

0.2

0.3

0.4 TAMANO

0.5

0.6

0.7

0.8

0

0.1

(a) APRIORI

0.2

0.3

0.4 TAMANO

0.5

0.6

0.7

0.8

(b) SUBDUE

+

0.4

0.2

0

79

+

0

0.1

0.2

0.3

0.4 TAMANO

0.5

0.6

0.7

0.8

(c) CC-EMO

objeto sobre objeto

objeto

?

sobre objeto

forma

?

forma

cuadrado c´ırculo (d) Ejemplo com´ un (e) Ejemplo destacado

Figura 3.11: Frentes de Pareto obtenidos para el dominio geom´etrico. A pesar de que hay soluciones dibujadas que parecer´ıan ser dominadas por otra soluci´ on, esto no es as´ı ya que no pertenecen al mismo vecindario en el espacio de variables.

por cada soluci´ on es menor a 0,5 y, por lo tanto, no pueden ser comparadas entre s´ı (recordar la discusi´ on de la Secci´ on 3.4). Como es f´ acil de observar, APRIORI y SUBDUE obtienen un n´ umero limitado de soluciones. En el caso de APRIORI, ´este realiza la b´ usqueda de soluciones optimizando un u ´nico objetivo, el n´ umero de instancias cubiertas, no siendo capaz de encontrar las soluciones o´ptimas. Esto es debido a que el sistema APRIORI no ha sido dise˜ nado para trabajar con bases de datos estructuradas. En el caso de SUBDUE, ´este identifica correctamente un conjunto de soluciones interesantes, pero pierde varios clusters valiosos. No puede obtener un conjunto adecuado de soluciones de compromiso debido a que el principio de

CAP´ITULO 3. METODOLOG´IA

80

APRIORI SUBDUE CC-EMO promedio (desvest)

S(X) 1,007766 2,72272 3,18960 (0 , 08025 )

M∗ 3 0,82202 1,12631 1,30384 (0 , 03789 )

(a) M´ etricas S y M∗3

APRIORI SUBDUE CC-EMO promedio (desvest)

M∗ 2 14 12 25,92379 (2 , 60579 )

|X| 14 13 26,70000 (2 , 62679 )

(b) M´ etrica M∗2

C(X 0 , X 00 ) APRIORI SUBDUE CC-EMO promedio (desvest)

APRIORI 0,07143 0,07857 (0 , 02259 )

SUBDUE 0,00000 0,00000 (0 , 00000 )

CC-EMO promedio (desvest) 0,00000 (0 , 00000 ) 0,00000 (0 , 00000 ) -

(c) M´ etrica C

N D(X 0 , X 00 ) APRIORI SUBDUE CC-EMO promedio (desvest)

APRIORI 10,00 24,60 (2 , 45855 )

SUBDUE 10,00 16,90 (1 , 66333 )

CC-EMO promedio (desvest) 10,80 (0 , 42164 ) 3,30 (1 , 25167 ) -

(d) M´ etrica N D

Tabla 3.2: Resultados de las m´etricas para el dominio geom´etrico. MDL es en realidad, una suma ponderada de objetivos –tama˜ no y soporte–, y se sabe que este tipo de enfoque produce soluciones sub´ optimas, como hemos comentado en la Secci´ on 2.5.1 [33]. Finalmente, el conjunto Pareto de CC-EMO contiene la mayor parte de las soluciones encontradas por el sistema APRIORI y el SUBDUE, y adem´ as obtiene una buena diversidad de soluciones de compromiso. Tambi´en es interesante notar que el algoritmo CC-EMO cubre una porci´ on del frente de Pareto correspondiente a aquellas soluciones con valores bajos de soporte pero con valores altos en tama˜ no, que los otros algoritmos no son capaces de descubrir. Para verificar num´ericamente estas afirmaciones, se calcular´ an diversas m´etricas sobre los resultados de los diferentes algoritmos, seleccionadas de entre los introducidos en la Secci´ on 2.5.3. Comenzaremos estudiando las m´etricas para conjuntos individuales. En la Tabla 3.2, se muestran los resultados de las m´etricas M∗2 , M∗3 y S. En la Figura 3.12 se muestran los boxplots asociados a las diez ejecuciones de CC-EMO para

´ DE LOS CLUSTERS GENERADOS 3.5. EVALUACION

3.05

22

1.26

3.10

1.28

24

3.15

1.30

26

1.32

3.20

28

1.34

3.25

30

1.36

81

(a) S

(b) M∗2

(c) M∗3

Figura 3.12: Boxplots de las m´etricas S, M∗2 y M∗3 para el CC-EMO en el dominio geom´etrico estas m´etricas. La m´etrica M∗2 muestra la diversidad de soluciones encontradas en el conjunto Pareto y, como puede verse en la Tabla 3.2(b), CC-EMO obtiene el conjunto Pareto m´ as diverso, lo cual tambi´en puede intuirse a la vista del frente del Pareto dibujado en la Figura 3.11. Por otro lado, la m´etrica M∗3 para un problema de optimizaci´ on de dos objetivos se calcula simplemente como la diferencia de las soluciones m´ as distantes del frente de Pareto. De los resultados de esta m´etrica, mostrados en la Tabla 3.2(a), y de la Figura 3.11, podemos inferir que CC-EMO cubre correctamente los extremos del frente de Pareto seguido por SUBDUE y APRIORI. Finalmente, la m´etrica S devuelve un valor num´erico que representa la cobertura del a´rea del Pareto. Como puede verse en la Tabla 3.2(a) y en la Figura 3.11, CC-EMO obtiene el mayor n´ umero y, por lo tanto, cubre mejor el espacio del frente del Pareto. Ahora estudiaremos las m´etricas de comparaci´ on entre distintos conjuntos Pareto. La m´etrica C es aquella que muestra la dominancia entre las soluciones de los diferentes enfoques. Como se puede inferir de los conjuntos Pareto obtenidos, ninguna soluci´ on de CC-EMO es dominada por ninguna otra soluci´ on de los otros dos algoritmos como puede verse en la tercera columna de la Tabla 3.2(c) y en la Figura 3.13(a). El sistema APRIORI no domina a ninguno de los otros dos enfoques, mientras que SUBDUE supera a APRIORI pero no a CC-EMO. Ninguna soluci´ on del SUBDUE domina a las de CC-EMO y viceversa. Finalmente, recordemos de la Secci´ on 2.5.3 que la m´etrica N D nos dice el n´ umero de soluciones de un algoritmo que no dominan y no son iguales a las soluciones de la otra poblaci´ on. En otras palabras, cuenta el n´ umero de individuos de un conjunto Pareto que no hayan sido encontrados y no est´en dominados por la otra poblaci´ on. De la Tabla 3.2(d) y la Figura 3.13(b), es f´ acil ver que CC-EMO descubre un n´ umero mayor de soluciones del Pareto que los

82

CAP´ITULO 3. METODOLOG´IA

otros dos sistemas, a pesar que es cierto que tanto APRIORI como SUBDUE encuentran soluciones novedosas que CC-EMO no logra obtener. Sin embargo, la cantidad de estas soluciones (10,8 y 3,3 de la Tabla 3.2(d)) es mucho menor en comparaci´ on con la m´etrica N D para CC-EMO (24,6 y 16,9 de la Tabla 3.2(d)).

3.6.

Compactaci´ on de la base de datos

Debido a que no todos los clusters obtenidos en la etapa de clustering conceptual pueden ser igualmente relevantes para todos los usuarios de la metodolog´ıa, es necesario depurar este conjunto. Es posible reducir la cantidad de soluciones y, por lo tanto, comprimir la base de datos de manera inteligente. Utilizando informaci´ on externa e independiente de los datos, correspondiente a un agrupamiento de esta nueva informaci´ on, llamado clusters de control, es posible seleccionar subconjuntos de clusters del conjunto total obtenido que sean m´ as relevantes con respecto a estos clusters de control. Es decir, seleccionar para cada cluster de control, un grupo de clusters que expliquen a las mismas instancias de la base de datos de una manera diferente utilizando informaci´ on independiente. En algunos dominios, es posible tener informaci´ on externa e independiente para realizar la compactaci´ on, pero en el caso del dominio geom´etrico no contamos con dicha informaci´ on y por ello generamos estos datos al azar (clustering de control) con la u ´nica finalidad de mostrar el proceso a realizar. A partir de estos datos externos, podemos realizar una comparaci´ on entre los clusters obtenidos mediante CC-EMO y la clasificaci´ on externa. Esta comparaci´ on se realizar´ a calculando la intersecci´ on de todos los clusters obtenidos por CC-EMO, a los cuales llamaremos ClustersB, contra aquellos del conjunto de control, llamados ClustersA. Para decidir si la intersecci´ on entre un ClusterA y un ClusterB es significativa, calcularemos su p-value utilizando la ecuaci´ on 3.7 [87]:   k−1 X fi g−f n−i  (3.7) P (ClusterA, ClusterB) = 1 − g i=0

n

donde f es el n´ umero total de instancias que pertenecen al ClusterA, n es el tama˜ no del ClusterB, k es el n´ umero de instancias pertenecientes a la intersecci´ on de ambos clusters (el de ClusterA y el de ClusterB), y g es el n´ umero total de instancias en la base de datos. Esta f´ ormula nos da la probabilidad de observar al menos k elementos del ClusterA en el ClusterB. Cuando m´ as cercano a 1 sea el valor del p-value, mayor probabilidad hay de que la intersecci´ on sea simplemente por azar y no sea relevante. En contraposici´ on, cuanto menor sea este valor, m´ as relevante ser´ a la intersecci´ on. Para la comparaci´ on se utilizar´ a un valor de umbral peque˜ no δ que permitir´ a decidir a partir de qu´e valor de p-value se considerar´ a que las intersecciones obtenidas no son aleatorias. Este valor de umbral es espec´ıfico para cada problema.

´ DE LA BASE DE DATOS 3.6. COMPACTACION

83

APRIORI

SUBDUE

CC-EMO

(a) Boxplots de la m´ etrica C

APRIORI

SUBDUE

CC-EMO

(b) Boxplots de la m´ etrica N D

Figura 3.13: Boxplots de las m´etricas C y N D para CC-EMO en el dominio geom´etrico

CAP´ITULO 3. METODOLOG´IA

1

···

10

Tama˜ no

8 ClustersA

84

15 20 22

0.0

··· p-value (a) Leyenda

0.5 2 5 3 ClustersB (b) Comparaci´ on

Figura 3.14: Ejemplo de intersecci´ on entre el clustering obtenido por la metodolog´ıa CC-EMO y el clustering de control En la Figura 3.14 se muestra un gr´ afico donde se compara el clustering obtenido por la metodolog´ıa y el clustering de control. Se puede ver que, en la Figura 3.14(b), cada intersecci´ on se representa con un circulo. S´ olo se grafican las intersecciones detectadas con un p-value por debajo del umbral seleccionado (δ = 0, 5). El eje horizontal representa los clusters de ClusterB mientras que el eje vertical muestra los clusters de ClusterA. Los c´ırculos aumentan su taman ˜o a medida que la cantidad de elementos de la intersecci´ on crece. El c´ırculo de menor tama˜ no corresponde a una intersecci´ on donde hay un solo elemento, mientras que el mayor c´ırculo contiene 10 elementos. El color de los c´ırculos tambi´en var´ıa dependiendo del p-value correspondiente a la intersecci´ on. Cuanto menor sea el p-value, m´ as rojo ser´ a el c´ırculo y, por lo tanto, m´ as relevante ser´ a la intersecci´ on; y cuanto m´ as verde sea, menos relevante ser´ a. Sobre el rect´ angulo de muestra con la graduaci´ on de colores, se indica el rango de los p-value. En el ejemplo se ha seleccionado un δ de 0,5 y, por ello, el rango se define en el intervalo [0;0,5]. Se han presentado cinco intersecciones en el ejemplo: {(ClusterB #2, ClusterA #8), (ClusterB #5, ClusterA #15), (ClusterB #5, ClusterA #20), (ClusterB #5, ClusterA #22), (ClusterB #3, ClusterA #20)}. La intersecci´ on (ClusterB #5,ClusterA #20) es la que contiene la mayor cantidad de elementos, pero tambi´en es una de las menos relevantes debido a que el color del circulo es claramente verde. Por otro lado, la intersecci´ on (ClusterB #2, ClusterA #8) tiene pocos elementos pero, a su vez, es la m´ as relevante ya que es la m´ as rojiza. Las dem´ as intersecciones ejemplifican diferentes situaciones donde el tama˜ no y el p-value var´ıan. Mediante esta comparaci´ on con el conjunto de control, es posible saber si los clusters obtenidos por nuestra metodolog´ıa son similares a aquellos obtenidos en el clustering de la base de datos de control. Esta comparaci´ on se realizar´ a

´ DE LA BASE DE DATOS 3.6. COMPACTACION

85

no s´ olo con los resultados de CC-EMO, sino tambi´en con los de los otros dos algoritmos con los cuales comparamos: APRIORI y SUBDUE. A la luz de esta comparaci´ on, es posible realizar una depuraci´ on de los resultados obtenidos, ya que el conjunto Pareto generado puede llegar a tener varias soluciones muy similares con objetivos contrapuestos que pueden ser subsumidos por una u ´nica soluci´ on. Por lo tanto, nuestra metodolog´ıa identifica aquellas subestructuras correspondientes a ClusterB que resultan indistinguibles desde el punto de vista del ClusterA, y las comprime en una u ´nica subestructura. Para ello, se realizan los siguientes pasos para cada cluster de control (ClusterA) (ver Algoritmo 3.1): (1) se seleccionan aquellos clusters de ClusterB con un pvalue menor al umbral dado, que intersecta al cluster de ClusterA, y se tiene en consideraci´ on solamente aquellas instancias incluidas en el ClusterA; (2) se excluyen aquellos clusters de ClusterB que sean dominados luego de recalcular la no dominancia en base al nuevo conjunto reducido de instancias, en lugar de la totalidad de la base de datos (ver las componentes rosas de la Figura 3.15); y (3) se organizan los clusters de ClusterB en clases de equivalencia utilizando la relaci´ on de inclusi´ on dada por la funci´ on Cubre (ver ecuaci´ on 3.3) (ver los componentes negros de la Figura 3.15). Luego de la reorganizaci´ on de los clusters en varias ramas, se selecciona un u ´nico cluster, el m´ as general, de cada una de ellas (ver los componentes verdes de la Figura 3.15). Esto es debido a que, a priori, ser´ıa ideal tener la uni´ on de todos los elementos de la rama, pero dado que los elementos de una misma rama se relacionan por una funci´ on de inclusi´ on, terminaremos eligiendo el concepto m´ as general. Algoritmo 3.1 Proceso de compactaci´ on ´ COMPACTACION (C ClustersB, D ClustersA, δ umbral) 1: para todo d ∈ D hacer 2: Q ← {c ∈ C | P (c, d) < δ} 3: Q0 ← {c ∈ Q | (¬∃x ∈ Q | (x ≺ c))} 4: Organizar en clases de equivalencia Y = {Y1 , . . . , Yr } a los c ∈ Q0 en base a la relaci´ on cubre (ver ecuaci´ on 3.3) 5: Q00 ← ∅ 6: para todo Yi ∈ Y hacer 7: Q00 ← Q00 ∪ {c ∈ Yi | (∀x ∈ Yi | c es m´ as general que x)} 8: fin para 9: Devolver Q00 10: fin para El enfoque anterior distingue nuestra metodolog´ıa de las t´ecnicas cl´ asicas de aprendizaje supervisado, en las que las estructuras no se construyen en base a su habilidad para distinguir ejemplos etiquetados o clases, sino que pueden ser comprimidas en base a informaci´ on independiente disponible. Es m´ as, nuestro enfoque utiliza una compresi´ on flexible, donde las estructuras pueden ser

CAP´ITULO 3. METODOLOG´IA

86 ClusterA #X

ClusterB #Y1

ClusterB #W1

ClusterB #W2

Las flechas corresponden a la relaci´ on “⊆” de ClusterB ClusterB #Q1

ClusterB #R1

ClusterB #R2

W1 es dominado por W2 ClusterB #R3 Cuanto m´ as alto en el a ´rbol, m´ as general el concepto

Figura 3.15: Ejemplo de compactaci´ on. La jerarqu´ıa viene dada por la relaci´ on entre los ClusterA y ClusterB. Los clusters coloreados corresponden a aquellos que se mantienen finalmente.

comprimidas y descomprimidas de acuerdo a los datos experimentales de comparaci´ on.

3.7.

Predicci´ on

CC-EMO utiliza un m´etodo de clasificaci´ on no-supervisado difuso basado en prototipos de k-vecinos (knn) [18] para predecir la clasificaci´ on de nuevas instancias, utilizando los conceptos extra´ıdos en la fase de clustering y depurados durante la etapa de compactaci´ on. Para calcular la pertenencia de una instancia xq a un conjunto de subestructuras I previamente identificadas, se utilizar´ a la ecuaci´ on 3.8. knn(xq , V1 , . . . , VI ) = Vi ∈ {1, . . . , I} / µi,q = max{µq,1 , . . . , µI,q }, ∀i

(3.8)

donde µi,q representa el grado de pertenencia de la instancia x q a la subestructura Vi . Las instancias pueden contribuir a m´ as de una subestructura con un grado de pertenencia µ diferente. El grado de pertenencia µi,q entre una instancia xq y una subestructura Vi es cero si la subestructura no cubre a la instancia. En el caso de que la

´ 3.7. PREDICCION

87

(a) Nueva instancia

? ?

#1

? #3

?

#4

#2 (b) Subestructuras

Figura 3.16: Ejemplo de predicci´ on para nuevas instancias. La instancia dada en (a) est´ a cubierta por las subestructuras pintadas en celeste

subestructura si la cubra, entonces el grado de pertenencia ser´ a equivalente al objetivo de especificidad utilizado durante el proceso de b´ usqueda. Por ejemplo, en la Figura 3.16(b) tenemos un conjunto de 4 subestructuras

CAP´ITULO 3. METODOLOG´IA

88

(I = 4) y en la Figura 3.16(a) tenemos una nueva instancia la cual queremos clasificar (xq ). Reemplazando en la f´ ormula tendremos: knn(xq , V1 , . . . , V4 ) = V2 / µi,q = max{µ1,q , µ2,q , µ3,q , µ4,q } = max{0,43; 0, 57; 0; 0} = 0, 57 con lo cual clasificaremos a la instancia xq con la subestructura V2 ya que la instancia tiene un mayor grado de pertenencia utilizando esa subestructura. Es interesante observar que las subestructuras descubiertas por la metodolog´ıa no permiten obtener conceptos de cluster como ser “dos objetos iguales sobre otro diferente”. Si al usuario le interesara descubrir esa clase de conceptos, necesitar´ıa modificar el sistema de modelado de los objetos. Si, por otra parte, al usuario le interesara extraer los conceptos de cluster que abarquen las descripciones con mayor cantidad de elementos, deber´ıa modificar los objetivos a optimizar, por ejemplo, contabilizar el tama˜ no de la subestructura solamente como la cantidad de nodos de tipo objeto. De esta manera, se realiza la retroalimentaci´ on y se vuelve a utilizar la metodolog´ıa, y as´ı sucesivamente hasta lograr obtener los resultados deseados.

3.8.

Comentarios finales

En el a´rea de la biolog´ıa, se utilizan grandes repositorios de datos que contienen informaci´ on de secuencias de ADN o prote´ınas de genomas completos. Esto es debido, en gran parte, a los avances en la Biolog´ıa Molecular y en el equipamiento disponible para la investigaci´ on en este campo, que ha permitido la r´ apida secuenciaci´ on de grandes porciones de genomas de diversas especies. Estas bases de datos contienen informaci´ on estructurada, ya que describen no s´ olo los objetos de las mismas, sino tambi´en las relaciones que existen entre ellos. A pesar del aumento constante de informaci´ on en estos repositorios, se hace casi imposible, para un ser humano, extraer informaci´ on u ´til de ellos. Se han desarrollado diversas t´ecnicas de miner´ıa de datos para poder revelar informaci´ on relevante que se encuentra oculta. Sin embargo, estas t´ecnicas no funcionan correctamente con representaciones de datos estructurados. Debido a ello, existe la necesidad de crear t´ecnicas que permitan analizar y descubrir nuevos conceptos, que difieran de los valores consenso, definidos mediante subestructuras en repositorios de datos estructurados. Para ello, hemos propuesto una metodolog´ıa llamada Clustering Conceptual basado en Evoluci´ on MultiObjetivo (CC-EMO) que extrae subestructuras interesantes de una base de datos estructurada considerando diferentes aspectos de las mismas. Dado un dominio, CC-EMO identifica patrones comunes representados por subestructuras mediante el uso de t´ecnicas de optimizaci´ on multiobjetivo.

3.8. COMENTARIOS FINALES

89

Debido a esto, obtenemos el mejor conjunto de subestructuras que sean conjuntamente o´ptimas en especificidad y sensibilidad en una misma ejecuci´ on, a diferencia de otros m´etodos donde cada criterio de evaluaci´ on debe aplicarse individualmente. Nuestra propuesta se diferencia de las t´ecnicas cl´ asicas de clustering en varios puntos: (1) CC-EMO encuentra las soluciones o´ptimas en m´ ultiples criterios, lo cual evita los sesgos que pueden resultar de utilizar un esquema espec´ıfico de peso sobre alguno de ellos; (2) CC-EMO permite la pertenencia de una instancia a m´ as de una subestructura, a diferencia de otros enfoques de clustering que prematuramente fuerzan a las instancias a pertenecer a clusters disjuntos; (3) CC-EMO realiza una selecci´ on de caracter´ısticas local para cada subestructura, dado que no todas las caracter´ısticas son relevantes para todos los grupos, en contraposici´ on a los enfoques que filtran o reducen caracter´ısticas para todos los posibles clusters; (4) CC-EMO tiene una naturaleza multimodal que permite la descripci´ on alternativa de un sistema, brindando de varias soluciones adecuadas, recuperando entonces soluciones localmente o´ptimas, a diferencia de otros m´etodos que est´ an focalizados en un u ´nico o´ptimo; y (5) CC-EMO difiere de los m´etodos de aprendizaje supervisado ya que no realiza un agrupamiento basado en una sola clase dada por un experto. M´ as a´ un, CC-EMO minimiza el n´ umero de subestructuras utilizando una estrategia de compactaci´ on flexible que agrupa aquellas que resulten similares, agrupando din´ amicamente en base a un criterio dado. Esto lo realiza bas´ andose en la capacidad de describir objetos utilizando caracter´ısticas independientes a las aplicadas en el proceso de aprendizaje, en lugar de enfoques que utilizan una compactaci´ on irreversible de la base de datos. Hemos aplicado la metodolog´ıa a un dominio sencillo basado en [54] y comparado con dos t´ecnicas de descubrimiento de subgrupos actuales –APRIORI y SUBDUE–. Los resultados obtenidos por CC-EMO superan, cuantitativamente, a los otros dos enfoques en todas las m´etricas utilizadas en la comparativa, mientras que, cualitativamente, se puede observar que en varios casos los resultados obtenidos han sido validado experimentalmente y otros sujetos a pr´ oxima experimentaci´ on.

90

CAP´ITULO 3. METODOLOG´IA

Cap´ıtulo

4

Aplicacio´n a organismos procariotas

E

n este cap´ıtulo, se aplicar´ a la metodolog´ıa propuesta al problema de regulaci´ on gen´etica en organismos procariotas. Para ello, se utilizar´ a una base de datos que contiene informaci´ on sobre diversos genes que est´ an regulados por el sistema regulatorio de dos componentes PhoP/PhoQ, tanto en el genoma de Escherichia coli (E. coli) como en el de Salmonella enterica (Salmonella). El sistema PhoP/PhoQ es un buen ejemplo de regulaci´ on procariota ya que controla la expresi´ on de un gran n´ umero de genes en varias familias de Enterobacterias. Debido a que PhoP y PhoQ pertenecen al mismo oper´ on, se utilizar´ an los t´erminos “inducido por el sistema regulatorio de dos componentes PhoP/PhoQ” e “inducido por phoP” indistintamente. El cap´ıtulo actual se dividir´ a en varias secciones siguiendo el esquema utilizado en el anterior. Se comenzar´ a con una introducci´ on al problema desde el punto de vista biol´ ogico, para luego mostrar en detalle los pasos de la metodolog´ıa en su aplicaci´ on al problema tratado. Finalmente, se realizar´ a una evaluaci´ on de los resultados obtenidos, tanto desde el punto de vista computacional como desde el experimental.

4.1.

Problema biol´ ogico: regulaci´on gen´etica

Uno de los desaf´ıos de la era post-gen´ omica consiste en entender cu´ ando y c´ omo se expresan los genes de un genoma. El concepto b´ asico subyacente en el control de la transcripci´ on en bacterias se basa en dos tipos de secuencias de ADN: secuencias que codifican productos que act´ uan en trans y secuencias que codifican productos que act´ uan en cis. Cuando los elementos regulatorios son de 91

92

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

naturaleza y origen diferente a la secuencia gen´etica a controlar, la regulaci´ on es de tipo trans, mientras que cuando el elemento regulador transcripcional es parte de la cadena nucleot´ıdica donde se localiza el gen a regular, se denomina regulador cis [63]. La descripci´ on de los elementos que participan en el proceso de regulaci´ on gen´etica resulta esencial para poder descubrir las diferencias entre regiones reguladoras que se encuentran co-reguladas y, por lo tanto, ayudan a comprender los mecanismos subyacentes por los cuales los sistemas regulatorios controlan la expresi´ on de los genes. En otras palabras, las descripciones de las regiones reguladoras relacionadas con los procesos de binding y transcripci´ on pueden ayudar a una mejor comprensi´ on de la din´ amica de las redes transcripcionales y, a futuro, permitir´ıan realizar predicciones del comportamiento de otros genes. Adem´ as, estas descripciones ser´ an esenciales para revelar las diferencias en el control entre genes de distintas especies que no han sido detectados por medio de una comparaci´ on global de las bases de datos de los diferentes genomas. El problema consiste entonces en saber distinguir los elementos que componen una regi´ on regulatoria de un gen de la mejor manera posible, como pueden ser los sitios de binding o los promotores. En general, los m´etodos computacionales se han concentrado en identificar propiedades independientes basadas en secuencias consenso que caracterizan diferentes aspectos en los procesos de regulaci´ on, tratando de homogeneizar las caracter´ısticas de las regiones reguladoras, a´ un incluso entre especies [88]. Sin embargo, es dif´ıcil descubrir las posibles diferencias fenot´ıpicas entre las regiones reguladoras que se encuentren co-reguladas dentro de una red, al igual que entre especies cercanas resultado de la regulaci´ on diferencial de genes hom´ ologos, debido al exceso de confianza en la alta conservaci´ on de las caracter´ısticas regulatorias entre las regiones reguladoras y las especies. Adem´ as, las propiedades regulatorias no pueden tratarse de forma independiente ya que sus relaciones est´ an intr´ınsecamente codificadas en el genoma. En este cap´ıtulo, nos centraremos en el problema de regulaci´ on en los organismos procariotas, en particular E. coli y Salmonella, los cuales presentan una diferencia significativa en la organizaci´ on de los genes con respecto a los organismos eucariotas. En las bacterias, los genes estructurales est´ an organizados en grupos, mientras que en los eucariotas aparecen en forma individual. Este agrupamiento, llamado oper´ on, permite que sean controlados de forma coordinada por medio de interacciones en un promotor u ´nico y, como resultado de las mismas, el grupo completo de genes es transcrito o no [5].

4.1.1.

La fase de transcripci´ on en organismos procariotas

Como hemos visto en la Secci´ on 4.1, la transcripci´ on implica la s´ıntesis de una cadena de ARN que representa a una de las cadenas de la doble h´elice del ADN. Con “representar” queremos decir que el ARN tiene una secuencia

´ ´ GENETICA ´ 4.1. PROBLEMA BIOLOGICO: REGULACION

93

id´entica a una de las cadenas del ADN, que se denomina cadena codificante. Esta cadena es complementaria a la otra, la cual proporciona un molde para su s´ıntesis. En la Figura 4.1 se muestra, de forma esquem´ atica, el proceso de transcripci´ on. El inicio de este proceso es un paso muy importante ya que es el punto de regulaci´ on principal que utiliza la c´elula para seleccionar qu´e prote´ınas se expresan y a qu´e velocidad.

Figura 4.1: Proceso de transcripci´ on del ADN a ARN Cuando la ARN polimerasa se ha unido fuertemente al promotor del ADN, ´esta separa la doble h´elice exponiendo un peque˜ no tramo de nucle´ otidos de cada hebra. La ARN polimerasa y el ADN sufren una serie de cambios estructurales reversibles que los sit´ uan en un estado energ´eticamente m´ as favorable. Con el ADN desenrollado, una de las dos hebras expuestas act´ ua como molde para el emparejamiento complementario de bases con los ribonucle´ otidos que se van incorporando, dos de los cuales han sido unidos por la ARN polimerasa

94

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

para iniciar la cadena de ARN. Una vez que se han incorporado al ARN los diez primeros nucle´ otidos aproximadamente, el factor σ relaja su fuerte uni´ on a la ARN polimerasa y se separa de ella. En este proceso, la ARN polimerasa vuelve a sufrir cambios estructurales que le permiten desplazarse r´ apidamente, transcribiendo sin el factor σ. La elongaci´ on de la cadena contin´ ua hasta que las enzima encuentra una segunda se˜ nal en el ADN, el terminador, donde la ARN polimerasa se detiene y libera el molde de ADN y la cadena de ARN reci´en sintetizada. Una vez que la ARN polimerasa se ha liberado en el terminador, vuelve a asociarse con una mol´ecula libre de factor σ y puede buscar un nuevo promotor, en el cual volver´ a a iniciar la transcripci´ on.

4.1.2.

Diferentes clases de activadores

La mayor´ıa de los activadores transcripcionales funcionan enlaz´ andose corriente arriba1 del sitio de inicio de la transcripci´ on en la localizaci´ on de los promotores. Por lo tanto, los activadores que reclutan a la ARN polimerasa a trav´es de una interacci´ on directa prote´ına-prote´ına se dividen en dos clases: clase I y clase II. Los activadores clase I se enlazan en ubicaciones corriente arriba y funcionan realizando una interacci´ on directa con una de las subunidades (αCTD) de la ARN polimerasa. Esta interacci´ on es suficientemente flexible para permitirle el enlace de esta subunidad en diferentes posiciones. Por el contrario, los activadores clase II se enlazan a sitios de binding que se superponen con el promotor en la regi´ on -35 del mismo. El lugar de posicionamiento de los activadores clase II no puede variar ya que est´ an restringidos a la localizaci´ on de uno de sus dominios σ [5].

4.1.3.

Promotores de ADN en organismos procariotas

Para transcribir correctamente un gen, la ARN polimerasa debe poder reconocer en qu´e punto del genoma comienza el gen y d´ onde acaba. Los procesos de inicio y terminaci´ on de la transcripci´ on implican una serie de complicadas transiciones estructurales en las mol´eculas de prote´ına, de ADN y de ARN que intervienen. De hecho, una comparaci´ on de muchos promotores bacterianos diferentes revela que tienen secuencias de nucle´ otidos heterog´eneas. Sin embargo, todas ellas contienen subsecuencias relacionadas, que reflejan parcialmente los aspectos del ADN que son reconocidos directamente por el factor σ. En general, estas caracter´ısticas comunes se denominan secuencias consenso. Una secuencia de nucle´ otidos consenso se deduce de la comparaci´ on de muchas secuencias que tienen la misma funci´ on b´ asica y se escoge el nucle´ otido que m´ as se repite en cada posici´ on. Por lo tanto, son como un resumen o “promedio” de un gran n´ umero de secuencias individuales de nucle´ otidos. 1 Las secuencias que se encuentran precediendo al sitio de iniciaci´ on se encuentran “corriente arriba” de ´ este. Aquellas secuencias que se encuentran despu´ es del sitio de iniciaci´ on (en la secuencia que se transcribe) est´ an “corriente abajo” del mismo.

´ ´ GENETICA ´ 4.1. PROBLEMA BIOLOGICO: REGULACION

95

Una raz´ on por la que los promotores bacterianos difieren en su secuencia de nucle´ otidos es debida a que esta secuencia es la que determina la fuerza del promotor (es decir, el n´ umero de veces que se inicia la transcripci´ on por unidad de tiempo). Los procesos evolutivos han ido modificando cada promotor de forma que la transcripci´ on se inicie tan a menudo como sea necesario, generando un amplio espectro de promotores. Los promotores de los genes que codifican las prote´ınas m´ as abundantes son mucho m´ as fuertes que los que est´ an asociados a genes que codifican prote´ınas menos frecuentes. Sus secuencias de nucle´ otidos son las responsables de estas diferencias. Es posible generar secuencias consenso que resuman sus caracter´ısticas m´ as relevantes. La variaci´ on que presentan en sus secuencias de nucle´ otidos dificulta a los investigadores la labor de localizarlos mediante una sencilla inspecci´ on de la secuencia de nucle´ otidos del genoma. A menudo, hace falta tener informaci´ on adicional, en parte procedente de la experimentaci´ on directa, para localizar con precisi´ on estas se˜ nales de ADN de peque˜ na longitud contenidas en el genoma. Las secuencias de los promotores son asim´etricas y esta caracter´ıstica tiene consecuencias importantes en su localizaci´ on en el genoma. Dado que el ADN es de doble hebra, en principio, a partir de cualquier gen se podr´ıan transcribir dos mol´eculas de ARN diferentes, utilizando cualquiera de las dos hebras de ADN como molde. Sin embargo, un gen t´ıpico tiene un solo promotor y, por lo tanto, la ARN polimerasa s´ olo se puede unir en una u ´nica direcci´ on. Por tanto, la ARN polimerasa no tiene m´ as opci´ on que transcribir una de las hebras de ADN ya que s´ olo puede sintetizar el ARN en direcci´ on 5’-3’. As´ı pues, la elecci´ on en cada gen de la hebra molde est´ a determinada no s´ olo por la localizaci´ on, sino tambi´en por la orientaci´ on de su promotor. Las secuencias de los genes revelan que la hebra de ADN utilizada como molde para la s´ıntesis de ARN var´ıa de un caso a otro. La divisi´ on de labores entre el n´ ucleo de la enzima que se encarga de la elongaci´ on de la cadena y el factor sigma que est´ a implicado en la selecci´ on del promotor, plantea la pregunta de si habr´ a m´ as de un tipo de sigma, cada uno especifico para una clase diferente de promotor. El factor m´ as com´ un, responsable de la transcripci´ on de la mayor´ıa de los genes en condiciones normales, es el σ 70 . Los factores sigma alternativos σ 32 , σ E y σ 54 , se activan en respuesta a cambios ambientales. Adem´ as, σ 28 se usa para la expresi´ on de genes flagelares durante el crecimiento normal, pero sus niveles de expresi´ on responden tambi´en a cambios ambientales. Todos los factores sigma excepto σ 54 pertenecen a la misma familia de prote´ınas y funcionan de la misma manera general descrita anteriormente. En particular, el promotor σ 70 –el cual se encuentra en la mayor´ıa de los genes del organismo E. coli– contiene dos secuencias, situadas en el extremo 5’ corriente arriba del primer nucle´ otido que se va a transcribir, que funcionan como centros promotores. Una de ellas, llamada secuencia Pribnow o regi´ on 10, contiene la secuencia consenso TATAAT y est´ a centrada a -10 pares de bases

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

96

(pb)2 . La segunda, llamada regi´ on -35, tiene la secuencia consenso TTGACA. La caracter´ıstica m´ as notable en las secuencias de promotores en E. coli es la ausencia de conservaci´ on en la secuencia de 60 pb que se asocia con la ARN polimerasa. En otras palabras, la secuencia de nucle´ otidos de la mayor parte del sitio de uni´ on es irrelevante. No obstante, existen algunos fragmentos que resultan cruciales para su funcionamiento. La conservaci´ on u ´nicamente de secuencias consenso de corta longitud es una caracter´ıstica t´ıpica de los sitios reguladores (como los promotores), tanto en los genomas procariotas como en los eucariotas. En los promotores bacterianos hay cuatro fragmentos que se conservan: el sitio de iniciaci´ on y la secuencia en la regi´ on -10; la secuencia en la regi´ on -35; y la separaci´ on entre las regiones -10 y -35. El sitio de iniciaci´ on es, en m´ as del 90 % de los casos, una purina. Es com´ un que el sitio de iniciaci´ on sea la base central en la secuencia CAT, pero la conservaci´ on de este triplete no es lo suficientemente alta como para que se considere como una se˜ nal obligatoria. Justo corriente arriba del sitio de iniciaci´ on, hay una regi´ on de 6 pb que es reconocible en casi todos los promotores. El centro del este hex´ amero se encuentra aproximadamente a 10 pb corriente arriba del sitio de iniciaci´ on, aunque la distancia var´ıa en los promotores conocidos desde 9 a 18 pb. El hex´ amero se denomina con frecuencia regi´ on -10, de acuerdo con su localizaci´ on. El consenso de esta secuencia es TATAAT y se puede representar de la forma: T80 A95 T45 A60 A50 T96 donde el sub´ındice indica el porcentaje de aparici´ on de la base encontrada con m´ as frecuencia, variando entre el 45 % y el 96 %. Una posici´ on en la que no hay una clara preferencia por ninguna base se indicar´ıa con una N. Si la frecuencia de aparici´ on indica su posible importancia para la uni´ on de la ARN polimerasa, deber´ıamos esperar que las bases m´ as importantes en la regi´ on -10 sean las TA iniciales altamente conservadas, y la T final casi completamente conservada. Otro hex´ amero altamente conservado se encuentra a 35 pb corriente arriba ´ del sitio de iniciaci´ on. Este se denomina regi´ on -35. El consenso es TTGACA y, de una forma m´ as detallada, responde a la expresi´ on: T82 T84 G78 A65 C54 A45 2 Las

posiciones de las bases se numeran en ambas direcciones en referencia al sitio de iniciaci´ on al que se le asigna la posici´ on +1. Los n´ umeros aumentan corriente abajo. La base situada justo antes del sitio de iniciaci´ on corresponde a la posici´ on -1 y los n´ umeros negativos se van incrementando corriente arriba.

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

97

Las regiones -35 y -10 est´ an separadas entre ellas por una distancia que oscila entre 16 y 18 pb en el 90 % de los promotores. Como excepciones, puede ser algo m´ as corta y tener 15 pb de longitud o ser m´ as larga y tener 20 pb. Aunque la secuencia en el trecho intermedio no es importante, la distancia es cr´ıtica para mantener los dos sitios a la separaci´ on adecuada para la geometr´ıa de la ARN polimerasa. Un promotor “t´ıpico” depende de sus regiones -35 y -10 para ser reconocido por la ARN polimerasa, pero alguna de estas secuencias puede estar ausente (en casos excepcionales) en algunos promotores. En al menos algunos de estos casos, el promotor no puede ser reconocido por la ARN polimerasa en solitario, y la reacci´ on requiere de la intervenci´ on de factores auxiliares que suplen la deficiencia en la relaci´ on intr´ınseca entre la ARN polimerasa y el promotor. Una caracter´ıstica significativa de los promotores para cada enzima es que tienen el mismo tama˜ no y localizaci´ on en relaci´ on con el sitio de iniciaci´ on, y que muestran secuencias conservadas s´ olo alrededor de los centros de las regiones -35 y -10. Las secuencias consenso para cada serie de promotores difieren unas de otras en una o ambas regiones -35 y -10. Esto significa que una enzima que contenga un determinado factor σ solamente puede reconocer su propia serie de promotores, por lo que la transcripci´ on de los diferentes grupos es mutuamente excluyente. Por tanto, la sustituci´ on de un factor σ por otro apaga la transcripci´ on de la serie de genes antigua y enciende la transcripci´ on de una nueva serie de genes.

4.2.

Construcci´ on de la base de datos estructurada

Para la construcci´ on de la base de datos, recuperamos las regiones interg´enicas de los operones (la regi´ on anterior, corriente arriba del cod´ on de inicio de la transcripci´ on, y hasta 50 pb corriente abajo del mismo), los promotores y la informaci´ on de los factores de transcripci´ on de los genomas de E. coli y Salmonella, existentes en la base de datos RegulonDB [84], provista por H. Salgado. Adem´ as, contamos con informaci´ on de la expresi´ on diferenciada entre la cepa salvaje y la cepa phoP de E. coli, la cual experimenta las condiciones inducidas por el sistema regulatorio de dos componentes PhoP/PhoQ. Cada instancia de la base de datos corresponde a cada regi´ on regulatoria inducida por phoP de un determinado gen, como puede verse en la Figura 4.2. Para el an´ alisis de la red regulada por phoP, nos centraremos en las cinco caracter´ısticas siguientes: 1. Los submotivos del PhoP-box3 (“Motivo”). 3 T´ ermino

asociado a la secuencia de ADN que es caracter´ıstica de las regiones donde hace

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

98

(a) Instancias de la base de datos antes al modelado

Nombre Genoma b1825

Motivo Orientaci´ on Interacci´ on

E. coli

1

directo

1

Cercano Medio Lejano claseI claseII claseI claseII claseI claseII 0,42 0,37 0 0 0,56 0,55

(b) Instancia de la base de datos tras el modelado

interacci´ on

b1825

cluster 1

motivo

orientaci´ on

directo

PhoP-box

cercano

cluster 1

cercano

claseI

lejano

claseII

lejano

claseI

claseII

(c) Instancia de la base de datos estructurada

Figura 4.2: Representaci´ on de la base de datos

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

99

2. La orientaci´ on del PhoP-box (“Orientaci´ on”). 3. La presencia de sitios de binding potenciales para 23 factores de transcripci´ on seleccionados de los promotores regulados por phoP (“Interacci´ on”). 4. Los niveles inducidos por phoP en la expresi´ on gen´etica (“Expresi´ on”). 5. La distancia relativa entre el PhoP-box y el sitio promotor y su clase (“Promotor”). A continuaci´ on se detallar´ an los pasos realizados para obtener cada una de las cinco caracter´ısticas que conforman la base de datos. La mayor parte de la codificaci´ on ha sido realizada usando el lenguaje perl y utilizando los m´ odulos para bioinform´ atica de bioperl v1.5.

4.2.1.

Submotivos del PhoP-box (“Motivo”)

Para identificar diferentes modelos de los motivos del sitio de binding de PhoP, realizamos una partici´ on del conjunto de datos, compuesto por genes que se sabe que est´ an regulados por phoP, en 70 % para entrenamiento y el restante 30 % para prueba. Debido a que los sitios de binding de phoP que tienen una semejanza d´ebil al motivo consenso son dif´ıciles de detectar, utilizaremos un proceso de varias etapas para incrementar la sensibilidad de la b´ usqueda sin disminuir su especificidad. Primero, codificaremos el motivo del sitio de binding de PhoP utilizando como modelo una matriz de pesos para cada posici´ on de la secuencia nucleot´ıdica (matriz de pesos). Se agrupan secuencias que son similares a PhoP en base a esta matriz de pesos, usando el m´etodo de clustering difuso C-means [18] (ver Secci´ on 2.3), aplic´ andole una transformaci´ on a los nucle´ otidos del patr´ on correspondiente a la matriz de pesos, convirti´endolos en variables dummy [35], y considerando una combinaci´ on de ´ındices para estimar el n´ umero de clusters [18, 19]. Este modelo consenso inicial se ha utilizado para buscar en las secuencias interg´enicas de las regiones promotoras de E. coli y Salmonella (hasta 800 pb corriente arriba y desde 50 pb corriente abajo del cod´ on de inicio predicho por la informaci´ on extra´ıda de la base de datos) en un esfuerzo por capturar miembros potenciales del regulador de phoP que detecte motivos d´ebiles. Agrupando las secuencias que se asemejan con el modelo inicial dado por el grado de similaridad del modelo a la partici´ on difusa, se detectan cuatro subconjuntos ensamblados en una nueva familia de modelos, M1 a M4 (ver Tabla 4.1). Se define adem´ as el cluster M0 que incluye a aquellos genes donde no se encuentra ning´ un submotivo de PhoP. binding una prote´ına reguladora, en este caso PhoP.

100

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

4.2.2.

Orientaci´ on y modelado del PhoP-box (“Orientaci´ on”)

Se ha detectado en [100] que, a diferencia de los promotores de phoP y mgtA, varios promotores regulados por phoP, como ompT y yhiW de E. coli y mig-14, pipD y pagC de Salmonella, contienen posibles sitios de binding de PhoP en ambas orientaciones. Algunos de ´estos ya se han propuesto para ser regulados indirectamente por phoP, debido a la falta de la orientaci´ on directa del sitio de binding. Para identificar correctamente el sitio de binding de PhoP y su orientaci´ on, agrupamos en forma iterativa las secuencias ubicadas corriente arriba del comienzo de los genes que tienen una coherencia de expresi´ on similar [73]. La coherencia de expresi´ on es una m´etrica utilizada para calcular cu´ an compacto es un conjunto de expresi´ on de genes. Dado un conjunto de genes K, que comparten un motivo particular y un mismo conjunto de datos de expresi´ on, se calculan las distancias eucl´ıdeas (ver ecuaci´ on 2.13) entre la media y los perfiles de expresi´ on para cada P = 0,5 × K × (K − 1) par de genes. La coherencia de expresi´ on de un motivo se define como p/P , donde p es el n´ umero de pares de genes cuya distancia eucl´ıdea supera un peque˜ no umbral. Para ello, construimos un modelo de matrices de pesos utilizando la m´etrica de coherencia de expresi´ on como funci´ on de optimizaci´ on, como se explica a continuaci´ on: (1) Seleccionamos como conjunto de datos a todas las secuencias ubicadas corriente arriba de los genes. (2) Aplicamos el programa Consensus [88] con longitudes de patr´ on entre 14 y 30 pb. (3) Agrupamos los patrones consenso correspondientes a las distintas matrices obtenidas utilizando el algoritmo de clustering difuso C-medias, aplic´ andoles una transformaci´ on a los nucle´ otidos de estos patrones para convertirlos en variables dummy [35]. (4) Evaluamos la sinergia4 entre los clusters y la expresi´ on de sus miembros mediante la coherencia de expresi´ on. (5) Seleccionamos el grupo con una mayor sinergia. (6) Mientras la distancia intra-clustering del grupo seleccionado sea mayor a un umbral dado, construimos patrones de consenso para el grupo en base a las secuencias que pertenecen al cluster y volvemos a (2); en otro caso, devolveremos la mejor matriz final basada en su e-value [50]. Adicionalmente, se incorporan restricciones para mejorar el poder de discriminaci´ on de la funci´ on de optimizaci´ on que gu´ıa la heur´ıstica. Cada cluster identificado en (2) ha sido utilizado para buscar patrones similares en una colecci´ on de sitios de binding de factores de transcripci´ on diferentes a PhoP, los cuales fueron obtenidos de la base de datos RegulonDB y de publicaciones cient´ıficas. Cualquier similaridad con estos motivos se ha considerado como un falso positivo (FP) y utilizado como una estrategia de depuraci´ on. 4 La sinergia es la integraci´ on de elementos que da como resultado algo m´ as grande que la simple suma de ´ estos, es decir, cuando dos o m´ as elementos se unen sin´ ergicamente crean un resultado que aprovecha y maximiza las cualidades de cada uno de los elementos individuales.

T

TGTTTA

TGTG[TG]

TGTTTA

[AT]

M1

T TATT[GT]A

CGTTC

TGTTTA

T

M2

A [GTC]TTTA

TG[AT]TT

TGTTTA

A

M3

A

TGTTTA

M4

T

TGTTTA

[AG]A[AT]A[CT] [ATG]GTTTA [AT]

TAATT

TGTTGA

T

Tabla 4.1: Motivos del sitio de binding de PhoP.

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

Consenso global

101

102

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

Una vez determinados los modelos, realizamos una b´ usqueda utilizando el programa Patser [88] en las regiones interg´enicas de los genomas completos de E. coli y Salmonella en ambas orientaciones, considerando utilizando un umbral reducido correspondiente a dos desviaciones est´ andar por debajo de la media obtenida en el conjunto de entrenamiento [74]. Se admite la presencia de m´ as de un sitio candidato de binding de PhoP en una misma regi´ on promotora.

4.2.3.

Sitios de binding de los factores de transcripci´ on (“Interacci´ on”)

Para el desarrollo de los modelos correspondientes a los sitios de binding para los diferentes factores de transcripci´ on existentes en la base de datos RegulonDB, se sigui´ o la siguiente secuencia de pasos: (1) Generamos matrices de pesos para cada factor de transcripci´ on utilizando el programa Consensus y seleccionamos la mejor matriz final para motivos de longitud entre 14 y 30 pb (utilizando las opciones de simetr´ıa de matrices [84]), en el caso que no se haya especificado una longitud espec´ıfica. (2) Buscamos estos modelos con el programa Patser en las regiones interg´enicas de los genomas de E. coli y Salmonella, utilizando la medida de rendimiento global [14] (ver Secci´ on 4.2.5.2) como umbral. Luego, caracterizamos las distancias entre los distintos sitios de binding de los factores de transcripci´ on en la misma regi´ on promotora para cada una de las regiones promotoras presentes en la base de datos RegulonDB. (3) Para cada regi´ on promotora, construimos un histograma de distancias entre los distintos sitios de binding de los factores de transcripci´ on. (4) Ajustamos el histograma utilizando una funci´ on de pertenencia difusa. (5) Caracterizamos apropiadamente las distancias entre el posible PhoP-box y otros posibles sitios de binding de sitios de transcripci´ on detectados en la misma regi´ on, utilizando los modelos aprendidos a partir de los histogramas. Finalmente, agregamos (2) y (5) utilizando operadores de l´ ogica difusa.

4.2.4.

Expresi´ on de genes (“Expresi´ on”)

El an´ alisis de microarray intenta identificar genes que se expresan diferencialmente bajo condiciones diferentes. El desaf´ıo de analizar estos datos es decidir qu´e constituye un cambio considerable. El enfoque usual consiste en analizar la distribuci´ on de los niveles de expresi´ on y utilizar la estad´ıstica para ayudar a definir un umbral. Esto funciona razonablemente bien con grandes conjuntos de datos y para genes que muestran un gran cambio en sus niveles de expresi´ on. Sin embargo, la distribuci´ on total de los niveles de expresi´ on puede ser en realidad una mezcla de dos o m´ as distribuciones independientes que incluyen genes que exhiben grandes cambios en la expresi´ on, como tambi´en aquellos con menores cambios en sus niveles. Por lo tanto, la aplicaci´ on de t´ecnicas estad´ısticas al conjunto total de los datos puede resultar inapropiada para describir el conjunto de

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

103

genes. Para compensar este sesgo, utilizamos un proceso en dos etapas para el an´ alisis de genes regulados por phoP. Primero, identificamos grupos de genes cuya expresi´ on muestra diferencias estad´ısticamente significativas entre la cepa salvaje y phoP de E. coli en cuatro experimentos GeneChip [100]. Este agrupamiento se realiza utilizando una variaci´ on del m´etodo de clustering difuso C-medias [19, 40] (ver m´ as adelante) y una combinaci´ on de ´ındices de validaci´ on para estimar el n´ umero de clusters [18, 19]. Segundo, construimos submodelos para tales grupos de expresi´ on calculando sus centroides con la ecuaci´ on 2.12 y buscando en el genoma de E. coli para caracterizar su similaridad con cada modelo, utilizando la ecuaci´ on 2.13. La expresi´ on de cada gen se ha representado como un vector de valores, definidos en el intervalo [0, 1], que indican la similaridad entre la expresi´ on del gen y cada submodelo. Agrupando los niveles de expresi´ on del conjunto semilla mediante t´ecnicas de clustering difuso, encontramos tres patrones diferentes, dos representando patrones regulados positivamente y uno que define patrones regulados negativamente. Se han modelado los tres patrones en base a los centroides de cada cluster. Los tres modelos que describe la caracter´ıstica “expresi´ on” son: E1, correspondiente a los genes regulados positivamente incluyendo phoP y phoQ, y otros genes regulados por phoP, en forma can´ onica; E2, consistente principalmente en genes regulados positivamente, con niveles de expresi´ on m´ as bajos que los de E1; y E3 que incluye los genes regulados negativamente. Luego, se han utilizado estos modelos para re-examinar los datos de microarray, utilizando como medida la similaridad de modelos. Esto ha permitido recuperar genes adicionales cuyos niveles de expresi´ on son muy d´ebiles y no han podido ser detectados utilizando los umbrales basados estrictamente en filtros estad´ısticos.

4.2.5.

Sitio de binding de la ARN polimerasa (“Promotor”)

Dado que los promotores σ 70 del organismo E. coli presentan secuencias suficientemente conservadas, se puede llegar a definir un modelo de esta clase de promotor. Debido a que la informaci´ on biol´ ogica no es muy precisa y, en algunos casos, es incompleta, haremos uso de una herramienta que nos permita modelar esta clase de situaciones. Por lo tanto, aprovecharemos la habilidad de la l´ ogica difusa [56] para definir motivos incompletos e imprecisos. Otra ventaja de utilizar esta clase de t´ecnicas es la flexibilidad e interpretabilidad de sus representaciones. De la descripci´ on biol´ ogica de un promotor σ 70 , podemos extraer tres patrones conservados y dos distancias entre ellos que pueden utilizarse como modelos para la detecci´ on de promotores. Los patrones son: la regi´ on -10 (TATAAT), la regi´ on -35 (TTGACA) y el sitio de inicio de la transcripci´ on (TSS). Las distancias son las correspondientes a la separaci´ on entre las regiones -35 y -10, y entre la regi´ on 10 y el TSS. Sin embargo, el tercer y u ´ltimo patr´ on, el TSS, es muy

104

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

sencillo de encontrar por azar en una secuencia de ADN. Esto resulta en una gran desventaja para la detecci´ on de este modelo, ya que la gran mayor´ıa de las instancias detectadas de este patr´ on son falsos positivos debido, en gran medida, ´ a la corta longitud que presenta. Esta es la raz´ on por la cual algunos algoritmos deciden no utilizar este motivo como parte de la b´ usqueda, y por eso nosotros tampoco lo utilizaremos. Si realizamos una b´ usqueda en forma manual de los patrones descritos en una secuencia de tama˜ no reducido, encontraremos que existen varias soluciones posibles. Cada una de ellas es mejor que las otras en uno o m´ as patrones y peor en otros. Por lo tanto, no es posible determinar cu´ al de estas soluciones es la mejor sin tener que realizar el experimento biol´ ogico para comprobarlo. Este hecho convierte el problema de reconocimiento de patrones de promotores de genes en un problema multiobjetivo. Adem´ as, cabe destacar que tambi´en es un problema multimodal ya que existe m´ as de una soluci´ on posible al problema presentado para cada patr´ on individualmente. Nuestra propuesta de modelado representa cada promotor, compuesto por las regiones -10 y -35 y la distancia que las separa, como tres modelos difusos parametrizados Mα1 , Mα2 , y Mα3 , donde α representa un modelo aproximado cuya funci´ on de pertenencia se aprende a partir de distribuciones de datos [56, 72]. Por lo tanto, para poder resolver el problema de predicci´ on de promotores, se han desarrollado tres modelos difusos diferentes. Los dos primeros, correspondientes a las regiones -10 y -35, se han obtenido utilizando la frecuencia consenso nucleot´ıdica como conjuntos difusos discretos [56]. De esta manera, el modelo difuso asociado al patr´ on TTGACA, Mα1 , se formula como: Mα1 (x) = µTTGACA (x) = G(µ11 (x1 ), . . . , µ16 (x6 ))

(4.1)

donde el conjunto difuso discreto correspondiente a cada nucle´ otido que compone el motivo se obtiene de la distribuci´ on de probabilidades asociada, es decir, de la probabilidad de aparici´ on de cada una de las cuatro letras del alfabeto en la posici´ on que ocupa; y G el operador de agregaci´ on difuso [72, 56]. En esta memoria, hemos utilizado la media aritm´etica como operador de agregaci´ on.

A C G T

T T G A C 3 10 3 58 32 9 3 14 13 52 10 5 68 10 7 78 82 15 20 10 (a) Motivo TTGACA

A 54 5 17 24

A C G T

T A T A A T 3 89 26 59 49 3 8 3 10 12 21 5 7 1 12 15 11 2 82 7 52 14 19 89 (b) Motivo TATAAT

Tabla 4.2: Distribuci´ on nucleot´ıdica de los motivos obtenida de [48].

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

105

Por ejemplo, tomando en cuenta la distribuci´ on nucleot´ıdica mostrada en la Tabla 4.2, extra´ıda de [48], el conjunto difuso del primer nucle´ otido del motivo se define como µ11 (x1 ) = A/0, 03+T/0, 78+G/0, 10+C/0, 09, y los otros conjuntos difusos correspondientes a las posiciones 2-6 se calculan de una manera an´ aloga. El segundo modelo difuso correspondiente al patr´ on TATAAT, M α2 , se genera de la forma: Mα2 (x) = µTATAAT (x) = G(µ21 (x1 ), . . . , µ26 (x6 ))

(4.2)

donde el conjunto difuso discreto asociado al primer nucle´ otido del motivo se define como µ21 (x1 ) = A/0, 03 + T/0, 82 + G/0, 07 + C/0, 08, como se muestra en la Tabla 4.2, y los conjuntos difusos correspondientes a las posiciones restantes se calculan de manera an´ aloga. Se decidi´ o utilizar este m´etodo para la construcci´ on de los conjuntos difusos a partir de las distribuciones de probabilidad dado que es una t´ecnica muy simple y econ´ omica. Sin embargo, existen otras t´ecnicas para la construcci´ on de conjuntos difusos a partir de este tipo de distribuciones estad´ısticas [56, 72], algunas de ellas m´ as complejas pero que pueden llegar a obtener mejores resultados. Consideraremos su estudio en trabajos futuros. El tercer modelo difuso, es decir, la distancia entre los dos patrones previos, on de pertenencia trianMα3 , se construye como un conjunto difuso, cuya funci´ gular tambi´en se ha aprendido a partir de las distribuciones de datos observadas en los promotores conocidos [48] (ver Figura 4.3(a)). 140

1

120 0.8

0.6

80

PUNTAJE

FRECUENCIA

100

60

0.4

40 0.2 20

0

14

15

16

17

18 DISTANCIA

(a)

19

20

21

22

0

a=15

c=17

b=21 DISTANCIA

(b)

Figura 4.3: Representaci´ on gr´ afica de Mα3 La distancia entre TTGACA-box y TATAAT-box se mide como una funci´ on triangular centrada en 17 donde toma el valor m´ aximo (uno), y a la derecha e izquierda de este punto el valor de la funci´ on decrece como puede verse en la ecuaci´ on

106

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

4.3 y la Figura 4.3. 8 < −0,25 ∗ d + 5,25, 0,5 ∗ d − 7,5, µ(d) = : 0,

si 17 ≤ d < 21 si 15 < d < 17 en otro caso

(4.3)

Con el fin de codificar el algoritmo de reconocimiento de promotores, se utilizaron tres funciones de aptitud, una para cada uno de los objetivos consistentes en la maximizaci´ on del emparejamiento de la subsecuencia con los tres modelos difusos: TTGACA-box (maximizar f1 (x) = Mα1 (x)), TATAAT-box (maximizar f2 (x) = Mα2 (y)) y la distancia entre estos dos patrones (maximizar f3 (x, y) = Mα3 (dist(x, y))): La b´ usqueda de las soluciones que pertenecen al conjunto Pareto o´ptimo se realiza utilizando un algoritmo exhaustivo que optimiza simult´ aneamente los tres objetivos. En trabajos anteriores [29, 78, 77], se han utilizado AGMOs pero, debido a que el espacio de b´ usqueda del problema es reducido, se pudieron obtener los resultados o´ptimos con un algoritmo exhaustivo en un tiempo razonable. 4.2.5.1.

Ajuste de los modelos

Como se ha visto en la secci´ on anterior, los tres modelos difusos construidos para describir los promotores que queremos identificar en secuencias de ADN se derivan de datos promedio de promotores previamente identificados en diferentes secuencias. Sin embargo, esto no nos asegura el m´ aximo rendimiento en el proceso de predicci´ on, ya que se obtienen una gran cantidad de resultados falsos positivos (FPs). Una posible soluci´ on a este problema es el ajuste de las funciones de pertenencia que componen los tres modelos difusos y, en particular, de los umbrales de pertenencia (una subsecuencia ser´ a considerada como perteneciente al modelo difuso Mαi cuando su valor de pertenencia al conjunto difuso correspondiente es mayor o igual que este umbral) de los mismos para incrementar el proceso de predicci´ on, minimizando el n´ umero de FPs sin reducir el n´ umero de resultados verdaderos positivos (VPs). De esta manera, se ajustar´ an las tres funciones de pertenencia de los tres modelos difusos (el motivo TTGACA, el motivo TATAAT y la distancia entre ellos) y se determinar´ a un umbral de pertenencia para cada uno de ellos para poder diferenciar entre los resultados VPs y FPs. Para este fin, se ha desarrollado un proceso de ajuste gen´etico [26] para optimizar los par´ ametros de las funciones de pertenencia y los umbrales de los modelos difusos. Se han tenido en cuenta dos posibles formas de realizarlo: (1) optimizar los modelos y los umbrales por separado; y (2) optimizarlos simult´ aneamente. La segunda opci´ on ha producido soluciones considerablemente mejores que la primera por lo que ha sido seleccionada como algoritmo de ajuste.

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

107

El procedimiento de ajuste, como ya se ha mencionado, intenta disminuir la cantidad de resultados FPs y, al mismo tiempo, no reducir la cantidad de VPs. Estos dos objetivos son claramente contrapuestos y es necesario conseguir una buena soluci´ on de compromiso. Para ello, en lugar de optimizar ambos objetivos de forma simult´ anea, realizaremos un ajuste multiobjetivo para luego seleccionar aquella soluci´ on del conjunto Pareto que mejor corresponda con nuestras necesidades. El algoritmo de ajuste se basa en un algoritmo mem´etico [67] que evoluciona los individuos de la poblaci´ on utilizando un esquema evolutivo generacional cl´ asico basado en un mecanismo de selecci´ on por torneo binario [42] (ver Secci´ on 2.4.2.2). La poblaci´ on del algoritmo se compone de un conjunto S de secuencias de ADN de entrada, donde existen varios promotores verdaderos y falsos, previamente identificados, extra´ıdos de [48]. A continuaci´ on describimos las distintas componentes del algoritmo evolutivo de ajuste: Representaci´ on de los cromosomas. Los cromosomas est´ an compuestos por tres partes diferentes: La primera secci´ on incluye tres n´ umeros reales, los cuales representan los tres umbrales de pertenencia para cada modelo, definidos como la tupla (umbralTTGACA , umbralTATAAT , y umbraldistancia(TTGACA,TATAAT) ). La segunda secci´ on del cromosoma codifica los par´ ametros de las funciones de pertenencia discretas asociadas a los dos motivos, correspondientes a la matriz de probabilidad para cada letra del alfabeto en cada posici´ on de los mismos, como se muestra en la Tabla 4.2. Finalmente, la tercera secci´ on corresponde a la funci´ on de pertenencia difusa triangular del modelo que especifica la distancia entre los motivos, codificada como una tupla de tres n´ umeros enteros (a, b y c), como se muestra en la Figura 4.3. Toda distancia menor a a o mayor a b tiene grado de pertenencia 0, mientras que la pertenencia m´ axima (1) se obtiene en c. Inicializaci´ on. La poblaci´ on inicial consiste en un conjunto de soluciones aleatorias que mantienen las caracter´ısticas originales de los modelos de [48] mostrados en la Tabla 4.2. Esto significa que, por ejemplo, en el patr´ on TTGACA, el nucle´ otido T es m´ as frecuente que el nucle´ otido C en la posici´ on 1, por lo que los individuos de la poblaci´ on inicial tambi´en conservan esta misma relaci´ on. Esto sucede para los dos primeros modelos, mientras que la tercera parte del cromosoma se inicializa siempre con la distribuci´ on original de [48], la representada en la Figura 4.3(a). Relaci´ on de no dominancia. Las funciones de aptitud consideradas en el proceso evolutivo de ajuste se muestran en las ecuaciones 4.4 y 4.5, donde N (x) es el

108

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

conjunto de individuos en el entorno de x que no son dominados por x. En este contexto, una soluci´ on x domina otra soluci´ on y como se explica en la Secci´ on 2.5.1. El entorno de un individuo x est´ a compuesto por todas las soluciones situadas a una distancia cercana de x. Esta distancia se calcula utilizando la ecuaci´ on 4.8. En esta implementaci´ on, todos los cromosomas con distancia ≤ 2 se consideran pertenecientes al mismo entorno. Objetivo1 =

X

noesdominado(i, N (i))

(4.4)

f alsospositivos(i, (N (i))

(4.5)

i∈S

Objetivo2 =

X i∈S

noesdominado(x, P ) = (

f alsospositivos(x, P ) =

|j∈N (i);ji| |N (i)|

0



∃k ∈ P ; k  x sino

(4.6)

noesdominado(x, P ) en otro caso

(4.7)

0 1

dist(x, y) = |x1 − y1 | + |x2 − y2 |

(4.8)

donde x1 /y1 es la primera posici´ on del primer motivo (TTGACA) en el cromosoma x/y y x2 /y2 es la primera posici´ on del segundo motivo (TATAAT) en el cromosoma x/y. Operadores gen´eticos. Con respecto a los operadores gen´eticos, el cruce se aplica a los tres motivos con igual probabilidad. Para el primer y el segundo motivo, se utiliza un cruce en un punto, donde el punto seleccionado se refiere a la posici´ on en el patr´ on. En este caso particular, las posiciones 2, 3, 4 y 5 de cada motivo pueden ser elegidas e intercambiadas. Por otro lado, para el motivo de la distancia, se selecciona al azar el genotipo de alguno de sus padres para componer el hijo en lugar de utilizar un cruce en un punto, dado que el operador de mutaci´ on ya hace esta funci´ on, como se explicar´ a m´ as adelante. Como en el caso del cruce, la mutaci´ on se aplica a cada uno de los tres motivos con igual probabilidad. La mutaci´ on de los dos primeros motivos se realiza en una posici´ on de 1 a 6 del patr´ on, sum´ andole un ruido (valor  peque˜ no) generado aleatoriamente en el intervalo {−10, 10} al valor de probabilidad seleccionado y ajustando las probabilidades restantes de la misma posici´ on para que mantengan una distribuci´ on v´ alida. Para el motivo de la distancia, se selecciona uno de los tres n´ umeros enteros de la tupla con igual probabilidad y se le suma un peque˜ no ruido aleatorio en el intervalo {−3, 3}, corroborando que la funci´ on de pertenencia triangular siga siendo v´ alida. Es importante notar que este proceso de mutaci´ on para el motivo de la distancia produce resultados muy similares a los de un cruce en un punto, por lo cual no se realiza el cruce para este motivo, logrando as´ı reducir los tiempos de ejecuci´ on sin la degradaci´ on de la calidad de las soluciones finales.

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

109

Finalmente, se utiliza un m´etodo de b´ usqueda local solamente en la primera parte del cromosoma, el cual codifica los umbrales para cada modelo difuso. Cualquiera de estos tres valores de umbral puede ser seleccionado con igual probabilidad, luego del cruce y la mutaci´ on. El operador de vecino involucra sumarle un ruido aleatorio al n´ umero entero seleccionado y el proceso se repite varias veces hasta que la soluci´ on resultante reduzca su valor de aptitud. La mejor soluci´ on obtenida en este proceso es la que se devuelve. 4.2.5.2.

Experimentos

Para la experimentaci´ on correspondiente al ajuste de los par´ ametros de los modelos y el aprendizaje de los umbrales, se han utilizado los datos extra´ıdos de la compilaci´ on realizada por Harley & Reynolds [48]. El trabajo realizado por estos autores recoge una serie de secuencias promotoras de ADN correspondientes al organismo E. coli, donde se muestran no s´ olo los nucle´ otidos que las componen, sino tambi´en las ubicaciones exactas de las regiones -10 y -35 dentro de cada una de las secuencias. Como se ha mencionado en la Secci´ on 4.1, puede suceder que un mismo gen contenga m´ as de un promotor asociado, donde cada uno se active en diferentes situaciones. En el art´ıculo de Harley & Reynolds, no s´ olo se muestra la ubicaci´ on del promotor principal, sino que tambi´en se indica la presencia de promotores alternativos para algunas de las secuencias. En total, se obtienen 272 secuencias nucleot´ıdicas de distintos tama˜ nos, entre 45 y 64 pb. Cada secuencia tiene asociado al menos un promotor, por lo cual obtendremos una base de datos de 272 secuencias promotoras con sus respectivas posiciones de los modelos descritas. Adem´ as, para algunas secuencias se describen uno o m´ as promotores adicionales, sumando un total de 80 promotores alternativos. En conclusi´ on, contamos con una base de datos de 352 secuencias promotoras con su respectiva descripci´ on de los modelos -10 y -35, informaci´ on que se muestra en la Tabla A.2 del Ap´endice de esta memoria. Se ha ejecutado el algoritmo de ajuste sobre un 80 % de la base seleccionada al azar como conjunto de entrenamiento y el 20 % restante de la base se ha empleado como prueba. Luego de la ejecuci´ on del algoritmo de ajuste, se han obtenido varias soluciones posibles, que esencialmente pueden subdividirse en dos grandes grupos: Soluciones locales: Involucran a todas aquellas soluciones que tienen un valor de aptitud m´ aximo (de 1) en el Objetivo2 . Esto quiere decir que no detectan FPs, pero al mismo tiempo su valor en el Objetivo 1 es bajo. Solamente integran este conjunto aquellas soluciones con valores objetivo (Objetivo1 ; Objetivo2 ) = (0, 487544; 1), ya que 0,487544 es el m´ aximo valor en soporte que consigue obtener el algoritmo de ajuste manteniendo el objetivo de FPs en su valor m´ aximo. Soluciones globales: Involucran a todas aquellas soluciones que tienen valores altos en ambos objetivos simult´ aneamente. Esto quiere decir que no

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

110

consiguen llevar a cero la cantidad de FPs pero consiguen un valor suficientemente alto, a la vez que abarcan a una gran cantidad de promotores de la base de datos. Solamente integran este conjunto aquellas soluciones con valores objetivo (Objetivo1 ; Objetivo2 ) = (0, 88968; 0, 847753), que son los valores m´ aximos obtenidos.

Decimos que son varias las soluciones en cada uno de estos conjuntos ya que, por lo general, peque˜ nas modificaciones en los valores de umbral y en los modelos no suelen modificar los valores en los objetivos y, por lo tanto, el algoritmo mantiene este conjunto de soluciones. Para los fines de la detecci´ on de promotores, preferimos utilizar soluciones globales que abarquen la mayor cantidad de instancias posibles de la base de datos de entrada y, por lo tanto, hemos escogido una soluci´ on global. A continuaci´ on mostraremos cu´ ales son los resultados obtenidos por el algoritmo de predicci´ on de promotores con y sin el ajuste de los modelos difusos. La predicci´ on de promotores sin la utilizaci´ on del ajuste detecta 311 de los 352 promotores de la base de datos, lo cual constituye un 88,35 % del total. Sin embargo, si se hace un estudio utilizando algunas de las m´etricas estad´ısticas cl´ asicas, se puede observar que los resultados obtenidos sin el ajuste de los par´ ametros no son u ´tiles para el usuario final, ya que la cantidad de soluciones obtenidas es muy grande en comparaci´ on con los resultados reales. Para ello, calcularemos el n´ umero de verdaderos positivos (VP), falsos positivos (FP), verdaderos negativos (VN), falsos negativos (FN), y los ´ınices de sensibilidad, especificidad y precisi´ on (v´ease las ecuaciones 4.9, 4.10 y 4.11). Adicionalmente, calcularemos dos m´etricas estad´ısticas llamadas valor de predicci´ on positiva (VPP) y rendimiento global (RG) [14], mostradas en las ecuaciones 4.12 y 4.13. Se intentan maximizar todas estas medidas, con la excepci´ on de los FPs y FNs. En la Tabla 4.3 se muestran los resultados para estas m´etricas utilizando la predicci´ on de promotores con los motivos difusos originales.

Medida VP FP VN FN

Valor 0.86 1.00 0.00 0.14

Medida Sensibilidad Especificidad Precisi´ on Valor de Predictividad Positiva (VPP) Rendimiento Global (RG)

Valor 0.88 0.00 0.44 0.47 0.45

Tabla 4.3: Resultados para la detecci´ on de promotores utilizando los modelos difusos originales

´ DE LA BASE DE DATOS ESTRUCTURADA 4.2. CONSTRUCCION

111

VP V P + FN VN especif icidad = V N + FP VP +VN precisi´ on = V P + V N + FP + FN VP V PP = V P + FP precisi´ on + V P P RG = 2

(4.9)

sensibilidad =

Medida VP FP VN FN

Valor 0.86 0.27 0.72 0.14

Medida Sensibilidad Especificidad Precisi´ on Valor de Predictividad Positiva (VPP) Rendimiento Global (RG)

(4.10) (4.11) (4.12) (4.13) Valor 0.86 0.73 0.79 0.76 0.78

Tabla 4.4: Resultados utilizando los modelos y umbrales ajustados Los resultados obtenidos por el algoritmo utilizando los modelos ajustados se muestran en la Tabla 4.4, mientras que aquellos correspondiente a los modelos originales se recogen en la Tabla 4.3. Comparando ambas tablas, se puede observar que, sin utilizar ning´ un umbral, el n´ umero de FPs es muy alto. A pesar que el n´ umero de VPs obtenido al ajustar los modelos y los umbrales es menor que sin realizar este procedimiento, la precisi´ on resultante es mucho mejor, como puede observarse de los valores de VPP y RG, que pasan de 0,47 y 0,45 a 0,76 y 0,8, respectivamente. Las distribuciones de nucle´ otidos para los motivos TTGACA y TATAAT ajustados con el AGMO se presentan en la Tabla 4.5. Se puede observar que, con respecto a las distribuciones de nucle´ otidos originales, existen varios cambios puntuales. Por ejemplo, para el motivo TTGACA, la probabilidad de la G de la tercera posici´ on aument´ o de 68/100 a 88/100. Para el motivo TATAAT, por el contrario, la probabilidad de la A en la segunda posici´ on disminuy´ o de 89/100 a 66/100. Adem´ as del reconocimiento de promotores, se necesita poder diferenciar entre promotores de clase I y promotores de clase II y modelar las distancias entre estos promotores y el PhoP-box. A continuaci´ on se explica como se realizaron estos dos procesos. Promotores clase I y clase II. Para diferenciar entre promotores clase I y clase II, utilizamos un analizador sint´ actico inteligente que eval´ ua la calidad de la

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

112

T T G A C A 0 10 0 72 13 72 12 1 10 15 79 17 0 6 88 5 8 2 88 83 2 9 0 5

A C G T

A C G T

(a) Motivo TTGACA

T A T A A 2 66 25 46 53 28 6 22 6 9 24 5 1 37 26 46 23 52 11 12

T 7 10 13 70

(b) Motivo TATAAT

Tabla 4.5: Distribuci´ on de nucle´ otidos ajustados para los motivos regi´ on -35 [13, 52], basado en una matriz de pesos. Distancias entre PhoP-box y promotor. Para construir los modelos de las distancias entre el sitio de binding de PhoP y un promotor, se calculan las distribuciones de distancias para cada tipo de promotor –clase I y clase II–. Posteriormente, se ajustan sus distribuciones en modelos basados en funciones de pertenencia difusa [56] (ver Figura 4.4), generando tres etiquetas difusas –cercano, medio y lejano–.

4.3.

Adaptaci´ on de CC-EMO para su aplicaci´ on al dominio de regulaci´ on gen´ etica en procariotas

Para poder aplicar el algoritmo CC-EMO a este nuevo dominio, es necesario primero realizar algunas modificaciones sencillas. Uno de los cambios necesarios es la codificaci´ on de los cromosomas del AG, para la que se mantendr´ a la estructura en forma de a´rbol de la base de datos estructurada, tal como se hace en el dominio geom´etrico del Cap´ıtulo 3. Pero, a diferencia de los a´rboles del dominio geom´etrico, ahora contamos con a´rboles m´ as complejos que no necesariamente son a´rboles binarios. As´ı, definimos seis clases diferentes de nodos, uno para cada atributo extra´ıdo de la base de datos [100]: Tipo 1 (Gen): Esta clase de nodo s´ olo tiene una posible etiqueta, {“gen”}. Este es el nodo ra´ız de todo cromosoma. A diferencia de las instancias, donde se ten´ıa un nodo ra´ız que conten´ıa el nombre del gen que representaban (ver Figura 4.2), ahora simplemente se tiene un nodo dummy que representa gen´ericamente a cualquier gen. Tipo 2 (PhoP-box): Esta clase de nodo s´ olo tiene una posible etiqueta: {“PhoP-box”}. En un a´rbol, pueden existir varios nodos de este tipo asociados a un nodo tipo 1 mediante un eje con etiqueta “tiene”. Cada nodo

´ AL DOMINIO DE REGULACION ´ GENETICA ´ 4.3. APLICACION EN PROCARIOTAS113

Figura 4.4: Modelado de las distancias entre PhoP-box y promotor. tipo 2 representa un sitio de binding de PhoP cuyas propiedades particulares estar´ an dadas por los nodos que est´en asociados a ´el. Tipo 3 (Motivo): Este tipo de nodo puede tener las etiquetas {0, 1, 2, 3, 4}. Cada n´ umero corresponde a un cluster particular del tipo motivo (M0, M1, M2, M3, M4) (ver Secci´ on 4.2.1). El cluster M0 indica que no existe ning´ un motivo conocido y, por lo tanto, no estar´ a asociado a un nodo de tipo 2, sino al nodo ra´ız (tipo 1). Los dem´ as clusters estar´ an asociados a alg´ un nodo tipo 2 por medio de un eje con etiqueta “motivo”. Tipo 4 (Orientaci´ on): Este tipo de nodo puede tener dos etiquetas posibles, {“directo”, “reverso”}, y estar´ a asociado a un nodo tipo 2 mediante un eje con valor direcci´ on. Este nodo representa la orientaci´ on del sitio de binding de PhoP, el cual puede estar situado en una de las dos hebra del ADN (directo 5’ a 3’) o en su complementaria (reverso 3’ a 5’). Tipo 5 (Interacci´ on): Esta clase de nodo puede tener las etiquetas {0, 1, 2, 3, 4}. Cada n´ umero corresponde a un cluster particular (I0, I1, I2, I3,

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

114

I4) (ver Secci´ on 4.2.3) y s´ olo puede estar asociado a un nodo de tipo 1 por medio de un eje con etiqueta “interacci´ on”. Tipo 6 (Promotor): Este tipo de nodo es el m´ as complejo, representa la existencia de un promotor. Pueden existir varios promotores por instancia y, por lo tanto, varios nodos de este tipo en el a´rbol. Existen dos posibles etiquetas, {“claseI”,“claseII”}, que representan un promotor clase I y un promotor clase II, respectivamente. Los nodos de tipo 6 estar´ an asociados siempre a un nodo tipo 2 indicando los promotores que trabajan con un sitio de binding de PhoP particular. Los ejes posibles son: {“cercano”, “medio”, “lejano”}, indicando a qu´e distancia se encuentra el promotor en cuesti´ on del sitio de binding de PhoP (ver Secci´ on 4.2.5). Las restricciones de los operadores gen´eticos vendr´ an dadas por las relaciones comentadas en la Secci´ on 3.4. Los objetivos que procura maximizar CC-EMO en forma conjunta son especificidad y sensibilidad. Para el caso espec´ıfico del dominio de regulaci´ on gen´etica en procariotas, se calculan como se muestra en las ecuaciones 3.1 y 3.2, utilizando las funciones Cubre y Tama˜ no definidas en las ecuaciones 3.3 y 3.4, al igual que en el dominio geom´etrico.

4.4.

Evaluaci´ on de los clusters

La base de datos utilizada para este dominio est´ a compuesta por 51 genes regulados por phoP. Sin embargo, como algunos de ellos presentan diferentes motivos de esta prote´ına que tambi´en se tendr´ an en cuenta, tendremos un total de 74 instancias en la base de datos, una por cada motivo de PhoP en cada gen regulado por este. La poblaci´ on inicial de CC-EMO est´ a compuesta por sub´ arboles elegidos aleatoriamente de la base de datos. Consideramos los mismos algoritmos de comparaci´ on que en el Cap´ıtulo 3, ARPIORI y SUBDUE. Los par´ ametros de los algoritmos utilizados para este dominio se muestran en la Tabla 4.6. El algoritmo CC-EMO se ha ejecutado 10 veces utilizando distintas semillas y el promedio de estas ejecuciones es el que se considerar´ a de ahora en adelante. Par´ ametro Tama˜ no de la poblaci´ on N´ umero de evaluaciones Probabilidad de cruce Probabilidad de mutaci´ on

Valor 100 50000 0,6 0,2

Tabla 4.6: Par´ ametros para el dominio de regulaci´ on gen´etica en procariotas

´ DE LOS CLUSTERS 4.4. EVALUACION

115

En la Figura 4.5 se muestran las soluciones Pareto obtenidas por cada uno de los algoritmos utilizados (APRIORI, SUBDUE y CC-EMO). Es necesario recordar que el conjunto Pareto para CC-EMO est´ a compuesto por la uni´ on de las soluciones para las 10 ejecuciones del algoritmo. Nuevamente, es necesario hacer notar que los frentes de Pareto requieren la misma explicaci´ on dada en la Secci´ on 3.5. Se puede ver en estos gr´ aficos que APRIORI y SUBDUE obtienen un n´ umero limitado de soluciones. En el caso particular de APRIORI, ´este encuentra alguna de las soluciones o´ptimas considerando solamente la cantidad de instancias que cubre cada cluster como objetivo a optimizar. Esto es debido a que, a pesar que el algoritmo APRIORI no ha sido dise˜ nado para trabajar con bases de datos estructuradas, la transformaci´ on de la base de datos a este sistema ha sido apropiada. En el caso de SUBDUE, este algoritmo encuentra correctamente las mejores soluciones para los objetivos de sensibilidad y especificidad por separado, lo que quiere decir que descubre los extremos del frente de Pareto, pero no puede llegar a encontrar buenas soluciones de compromiso por las mismas razones comentadas en la Secci´ on 3.5. Finalmente, el conjunto Pareto para CC-EMO contiene la mayor´ıa de las soluciones encontradas por los sistemas APRIORI y SUBDUE, y adem´ as una gran diversidad de soluciones de compromiso. Para verificar estas u ´ltimas afirmaciones, consideraremos las mismas m´etricas empleadas en la Secci´ on 2.5.3. Comenzaremos estudiando las m´etricas para conjuntos Pareto individuales. En la Tabla 4.7 se muestran todos los resultados para las m´etricas M ∗2 , M∗3 y S. Los boxplots asociados a cada m´etrica para CC-EMO se ilustran en la Figura 4.6. La m´etrica M∗2 muestra la diversidad de soluciones encontradas en un conjunto Pareto y, como se observa la Tabla 4.7(b), CC-EMO es claramente el algoritmo con mejor diversidad de soluciones. Este hecho tambi´en puede verse en los frentes de Pareto de la Figura 4.5. La m´etrica M∗3 muestra que CC-EMO cubre mejor los extremos del frente de Pareto que APRIORI, pero SUBDUE logra detectar una soluci´ on a´ un m´ as en el extremo que CC-EMO no logra encontrar debido a la limitaci´ on de tama˜ no de la poblaci´ on, como puede verse en la Tabla 4.7(a) y en la Figura 4.5. Finalmente, para la m´etrica S, recogida en la Tabla 4.7(a) y en la Figura 4.6, CC-EMO obtiene el valor m´ as alto y, por lo tanto, cubre mejor el espacio del frente del Pareto. Ahora estudiaremos las m´etricas de comparaci´ on de conjuntos Pareto. Con respecto a la m´etrica C, como puede verse en la Tabla 4.7(c) y en la Figura 4.7(a), tanto CC-EMO como APRIORI tienen soluciones que se dominan las unas a las otras, pero CC-EMO obtiene mejores resultados globales. Por otro lado, CC-EMO domina a SUBDUE con un ´ındice mayor que SUBDUE a CCEMO. El algoritmo SUBDUE y el APRIORI no se dominan entre s´ı, ya que el valor de la m´etrica en la comparativa es cero.

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

116

1

1

+

0.8

0.4

0.6

0.4

0.6

0.4

0.2

0.2

0.2

0

0

0

0

0.1

0.2

TAMANO

0.3

0.4

0.5

0

(a) APRIORI

+

0.8

SOPORTE

0.6

SOPORTE

SOPORTE

0.8

1

+

0.1

0.2

TAMANO

0.3

0.4

0.5

+

0

0.1

(b) SUBDUE

Gen

TAMANO

0.3

0.4

0.5

(c) CC-EMO

interacci´ on

Gen

cluster 3

PhoP-box

0.2

PhoP-box cercano

medio

cercano

claseII

claseII

claseII

(d) Modelo en com´ un

(e) Ejemplo destacado

1.14 1.13

4.70

1.11

39

4.75

1.12

40

4.80

41

4.85

1.15

4.90

42

1.16

4.95

43

1.17

5.00

Figura 4.5: Frentes de Pareto para el dominio de regulaci´ on gen´etica en procariotas.

(a) S

(b) M∗2

(c) M∗3

Figura 4.6: Boxplots de las m´etricas S, M∗2 y M∗3 para CC-EMO en el dominio de regulaci´ on gen´etica en procariotas. Por u ´ltimo, la m´etrica N D muestra en la Tabla 4.7(d) y en la Figura 4.7(b) que CC-EMO descubre m´ as soluciones no dominadas que los otros dos algo-

´ DE LOS CLUSTERS 4.4. EVALUACION

117

APRIORI

SUBDUE

CC-EMO

(a) Boxplots de la m´ etrica C

APRIORI

SUBDUE

CC-EMO

(b) Boxplots de la m´ etrica N D

Figura 4.7: Boxplots de las m´etricas C y N D para CC-EMO en el dominio de regulaci´ on gen´etica en procariotas.

118

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

S(X) 2,5336 3,9095 4,81534 (0 , 11009 )

APRIORI SUBDUE CC-EMO prom. (desv est)

M∗ 3 0,9024 1,1854 1,15476 (0 , 02411 )

(a) M´ etricas S y M∗3

APRIORI SUBDUE CC-EMO prom. (desv est)

M∗ 2 21,3333 17,3684 41,28952 (1 , 95847 )

|X| 22 20 42,8 (1 , 8738 )

(b) M´ etrica M∗2

C(X 0 , X 00 ) APRIORI SUBDUE CC-EMO prom. (desv est)

APRIORI 0,00000 0,02727 (0 , 03178 )

SUBDUE 0,00000 0,09 (0 , 08433 )

CC-EMO prom. (desv est) 0,01203 (0 , 02063 ) 0,02981 (0 , 024 ) -

(c) M´ etrica C

N D(X 0 , X 00 ) APRIORI SUBDUE CC-EMO prom. (desv est)

APRIORI 18 33,3 (2 , 75076 )

SUBDUE 20 32,3 (2 , 11082 )

CC-EMO prom. (desv est) 12,4 (1 , 89737 ) 9 (1 , 76383 ) -

(d) M´ etrica N D

Tabla 4.7: Resultado de las m´etricas para CC-EMO en el dominio de regulaci´ on gen´etica en procariotas.

ritmos. APRIORI y SUBDUE encuentran muy pocas soluciones que CC-EMO no llega a obtener (12,4 y 9 en promedio de la Tabla 4.7(d)). La diferencia de valores mostrada por la m´etrica N D para CC-EMO en contraste con APRIORI y SUBDUE (33,3 y 32,3 contra solamente 12,4 y 9 de la Tabla 4.7(d)) muestra cu´ an bien se comporta nuestra metodolog´ıa en este dominio. En cuanto a los tiempos de ejecuci´ on, para CC-EMO son aproximadamente de unos once minutos, mientras que para APRIORI y SUBDUE son s´ olo de un par de minutos.

´ DE LA BASE DE DATOS 4.5. COMPACTACION

4.5.

119

Compactaci´ on de la base de datos

Aparte de la informaci´ on sobre las propiedades de orientaci´ on, motivo, promotor e interacci´ on, contamos con informaci´ on sobre la expresi´ on de cada uno de los genes regulados por phoP de la base de datos (ver Secci´ on 4.2.4). Como ya se ha mencionado dicha secci´ on, se ha agrupado esta informaci´ on en 3 clusters: E1, E2 y E3 (ver Figura 4.8(a),(b),(c) respectivamente). Por lo tanto, tenemos los mismos genes agrupados de dos maneras diferentes, utilizando informaci´ on independiente una de la otra: por un lado, en funci´ on de la expresi´ on (ClustersA), y por otro, considerando las cuatro propiedades restantes, haciendo uso de nuestra metodolog´ıa CC-EMO (ClustersB). Teniendo esta informaci´ on de control, podremos depurar los clusters encontrados tanto por CC-EMO como por los dos algoritmos de comparaci´ on, qued´ andonos solamente con aquellos que resulten m´ as relevantes de acuerdo a los datos externos. En las Figuras 4.9(a) y 4.9(b) se ilustran las intersecciones de APRIORI y SUBDUE con respecto a los perfiles de expresi´ on E1, E2 y E3. Adem´ as, la Figura 4.9(c) muestra las intersecciones con respecto a CC-EMO. Los gr´ aficos representan cada intersecci´ on con un c´ırculo, cuyo tama˜ no crece a medida que aumenta el n´ umero de instancias en la intersecci´ on entre los clusters, mientras que el color muestra el p-value para la intersecci´ on (ver la Secci´ on 3.6). No se representan las asociaciones con valores de p-value mayores a un umbral de 0, 1, ya que no ser´ıan suficientemente significativas. Como puede observarse, APRIORI y SUBDUE encuentran un menor n´ umero de clusters relevantes en comparaci´ on con CC-EMO. Estudiaremos ahora algunos ejemplos de estas intersecciones encontradas por CC-EMO para comprender mejor los resultados obtenidos. La compactaci´ on de los clusters se realiza como se describi´ o en la Secci´ on 3.6. En la Figura 4.10, se ejemplifica para este dominio el proceso de compactaci´ on para el cluster 2 de ClustersA. En este ejemplo, se elige un cluster de cada rama generada en base a las descripciones de los Clusters, remarc´ andose en color el cluster elegido para cada rama. En el caso de la rama de color verde, tanto el cluster 39 como el 94 de ClustersB involucran a los mismos genes y, por lo tanto, se prefiere el primer cluster al segundo. Pero, dado que el cluster 105 cubre a m´ as genes y, adem´ as, es m´ as general que el cluster 39 de ClustersB, se selecciona finalmente el cluster 105 de ClustersB como representante de la rama. Como primer ejemplo, podemos analizar la descripci´ on del cluster 78 de ClustersB encontrado por CC-EMO que intersecta con el cluster 1 de ClustersA en la Figura 4.11. Esta descripci´ on incluye, entre otros, a los genes {phoP, mgtA, ybcU, yhiW} de E. coli y a slyB de Salmonella, los cuales presentan el perfil can´ onico de los genes regulados por phoP, es decir, tienen los mismos patrones de expresi´ on, submotivo de PhoP-box, y comparten los mismos sitios de binding de la ARN polimerasa y de otros factores de transcripci´ on. Este perfil incluye no s´ olo a los promotores protot´ıpicos phoP y mgtA, sino tambi´en a yhiW del

25000 20000 15000 10000 5000 0

0

5000

10000

15000

20000

25000

30000

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

30000

120

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

WT1

WT2

WT3

MT1

MT2

MT3

MT4

(b) E2

0

5000

10000

15000

20000

25000

30000

(a) E1

WT4

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

(c) E3

Figura 4.8: Clusters de expresi´ on para el dominio de regulaci´ on gen´etica en procariotas.

cual no se ten´ıa informaci´ on de que se encontrara bajo el control de phoP. Este cluster no es detectado por APRIORI ni por SUBDUE. Otro ejemplo es el cluster 26 de ClustersB encontrado por CC-EMO que intersecta tambi´en con el cluster 1 de ClustersA. La descripci´ on de este cluster se muestra en la Figura 4.12 e incluye, entre otros, a los genes ompT de E. coli y a {pipD, ugtL, ybjX} de Salmonella, los cuales comparten sitios de la ARN polimerasa, patr´ on de expresi´ on y otros factores de transcripci´ on y orientaciones similares, claramente opuestos a las regiones promotoras protot´ıpicas de phoP y mgtA. Del grupo de genes descrito por el concepto mostrado en la Figura 4.12,

´ DE LA BASE DE DATOS 4.5. COMPACTACION

121

1 2 3 2

3

4

5

6

7 18 19 40 41 42 43 8

9 12 13 10 11

(a) APRIORI

1 2

3 14 15 16 17 18 19 20 21 22 23 24 25 26 27 (b) SUBDUE

1

···

30

0,00

···

0,02

1 1

7

9 13 16 18 20 26 38 48 57 58 63 66 67 68 70

1 78 87 92 97 100 102 103 104 106 108 109 110 111 113 114 117 2 3 39 73 89 105 62 94 (c) CC-EMO

Figura 4.9: Intersecci´ on de los ClustersA y ClustersB para APRIORI, SUBDUE y CC-EMO.

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

0

5000

10000

15000

20000

25000

30000

122

WT3

WT4

MT1

MT2

MT3

MT4

MT4

30000

MT3

30000

MT2

WT2

WT3

WT4

MT1

MT2

MT3

MT4

25000 20000 10000 0

5000

10000 5000 0 WT1

#105

15000

20000

25000

#94

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

WT1

30000

WT2

MT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

5000

10000

15000

20000

25000

#39

0

WT1

WT4

15000

20000 15000 10000 5000 0

0

5000

10000

15000

20000

WT3

#89

25000

#73

25000

WT2

30000

30000

WT1

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

Figura 4.10: Expresi´ on del cluster 2 de ClustersA y su relaci´ on con los ClustersB con los cuales interseca. Los ClustersB representados corresponden a la intersecci´ on entre ´estos y el cluster 2 de ClustersA. La jerarqu´ıa viene dada por la relaci´ on entre los t´erminos de GO de cada cluster conceptual. Los gr´ aficos remarcados corresponden a aquellos clusters que contienen los mismos genes.

s´ olo uno no presenta los mismos patrones de expresi´ on que el resto del conjunto. Este cluster no es detectado por APRIORI pero s´ı por SUBDUE. Por u ´ltimo, el cluster 73 de ClustersB encontrado por CC-EMO, que tambi´en intersecta con el cluster 2 de ClustersA, es otro ejemplo destacable. La descripci´ on de este cluster se muestra en la Figura 4.13 e incluye, entre otros, a los genes {hdeA, hdeD} de E. coli, los cuales componen un conjunto de genes estructurales bien diferenciados. Este cluster no es detectado ni por APRIORI ni por SUBDUE.

4.6.

Predicci´ on

Una vez concluido el proceso de clustering y la compactaci´ on de los clusters generados, se pueden clasificar nuevas instancias en los diferentes conjuntos ob-

´ 4.6. PREDICCION

25000

30000

123

PhoP-box cercano

0

motivo

5000

cluster 3

10000

15000

20000

Gen

interacci´ on

cluster 2

claseII

(a) Descripci´ on del cluster

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

(b) Expresi´ on del cluster intersecando el ClusterA #1

25000

30000

Figura 4.11: Descripci´ on del cluster 78 de ClustersB

cluster 3

10000

15000

20000

Gen PhoP-box medio

direcci´ on

claseII

0

cercano

claseI

5000

interacci´ on

reverso

(a) Descripci´ on del cluster

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

(b) Expresi´ on del cluster intersecando el ClusterA #1

Figura 4.12: Descripci´ on del cluster 26 de ClustersB

tenidos. Dado que los clusters no son disjuntos, puede que una instancia dada pertenezca a m´ as de un conjunto. Tal como se explica en la Secci´ on 3.7, nuestra metodolog´ıa utiliza un clasificador difuso basado en el k-prototipo m´ as cercano. El c´ alculo del grado de pertenencia de la observaci´ on x q en el conjunto I de subestructuras previamente identificadas se realiza mediante la ecuaci´ on 3.7.

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

25000

30000

124

cluster 3

PhoP-box medio

10000

15000

20000

Gen

motivo

claseI

claseII

0

cercano

5000

interacci´ on

cluster 4

WT1

WT2

WT3

WT4

MT1

MT2

MT3

MT4

(b) Expresi´ on del cluster intersecando el ClusterA #2

(a) Descripci´ on del cluster

Figura 4.13: Descripci´ on del cluster 73 de ClustersB Nombre

Genoma

pagK pagK

Salmonella Salmonella

Motivo Direcci´ on Interacci´ on 4 4

reverso reverso

3 3

Cercano Medio Lejano claseI claseII claseI claseII claseI claseII 0 0 0,5 0,50505 0 0 0 0,55 0 0 0 0

Tabla 4.8: Descripci´ on de la regi´ on regulatoria de pagK Por ejemplo, podr´ıamos querer clasificar la regi´ on regulatoria de pagK de Salmonella descrita en la Tabla 4.8. De todos los clusters generados por CC-EMO y depurados en el proceso de validaci´ on, pagK tiene un grado de pertenencia mayor a cero con los clusters 7, 87, 103, 104, 110 y 113 de ClustersB. Estos valores son 0,15556; 0,11111; 0,2; 0,11111; 0,18888 y 0,06667, respectivamente. Por lo tanto clasificaremos pagK como perteneciente al ClusterB 103: knn(xq = pagK, V7 , V87 , V103 , V104 , V110 , V113 ) = V103 / µi,q = max{µ7,q , µ87,q , µ103,q , µ104,q , µ110,q , µ113,q } = = max{0, 15556; 0, 11111; 0, 2; 0, 11111; 0, 18888; 0, 06667} = 0,2

4.7.

Comentarios finales

En este cap´ıtulo se ha aplicado la metodolog´ıa propuesta a un problema de regulaci´ on gen´etica en dos organismos procariotas, E. coli y Salmonella. Para ello, se ha recogido informaci´ on sobre diversos genes que est´ an regulados directa

4.7. COMENTARIOS FINALES

125

o indirectamente por el gen phoP en ambos genomas. Durante la etapa de construcci´ on de la base de datos, se generaron diversos modelos basados en l´ ogica difusa, aprendizaje autom´ atico y algoritmos evolutivos multiobjetivo. Gracias a estos modelos, se ha podido detectar nuevas instancias de estos modelos dentro de los genomas utilizados, que no hab´ıan sido obtenidas utilizando m´etodos cl´ asicos. En el caso espec´ıfico del reconocimiento de promotores, el cual constituye un problema de optimizaci´ on multimodal y multiobjetivo, se ha conseguido una mayor precisi´ on e interpretabilidad al utilizar sistemas gen´eticos difusos. Asimismo, el m´etodo de reconocimiento propuesto se ha validado mediante la predicci´ on de promotores del organismo E. coli, mediante un algoritmo que combina las ventajas de la representaci´ on de caracter´ısticas basadas en conjuntos difusos y las capacidades de b´ usqueda de los algoritmos evolutivos multiobjetivo. Se ha conseguido una mejora en la precisi´ on de los modelos gracias al ajuste de los mismos mediante un algoritmo de ajuste multiobjetivo basado en algoritmos mem´eticos. Esta mejora ha reducido, en gran medida, la cantidad de resultados falsos positivos obtenidos anteriormente. El proceso de compactaci´ on basado en informaci´ on externa, en este caso, datos sobre los niveles de expresi´ on de cada gen, provee al usuario de una explicaci´ on de cada conjunto de genes que se expresan en forma similar. Esta explicaci´ on se realiza en base a las caracter´ısticas de la regi´ on reguladora de estos genes. Diferentes conjuntos de control podr´ an entonces ser descritos en base a estas caracter´ısticas sin necesidad de repetir el proceso de generaci´ on de subestructuras. Por u ´ltimo, es importante destacar la capacidad de la metodolog´ıa de predecir el comportamiento de nuevos genes en base a los conceptos aprendidos y depurados, convirti´endola en una herramienta de caja blanca precisa y, a la vez, interpretable. La aplicaci´ on de la metodolog´ıa propuesta al problema tratado en este cap´ıtulo, gener´ o buenos resultados, los cuales han sido validados experimentalmente [100]. Asimismo, los resultados obtenidos han logrado superar a los conseguidos por los otros dos enfoques –APRIORI y SUBDUE– utilizados en la comparativa.

126

´ A ORGANISMOS PROCARIOTAS CAP´ITULO 4. APLICACION

Cap´ıtulo

5

Aplicacio´n a organismos eucariotas

L

a metodolog´ıa propuesta en el Cap´ıtulo 3 se aplicar´ a en este cap´ıtulo al problema de regulaci´ on gen´etica en organismos eucariotas. Para ello, se utilizar´ a una base de datos que contiene informaci´ on sobre diversos genes implicados en un estudio de la respuesta inflamatoria de seres humanos al aplicarles una endotoxina en forma intravenosa, en comparaci´ on con un grupo de control al cual se le inyecta un placebo [79]. Para modelar esta base de datos, se utilizar´ a un repositorio estructurado llamado Gene Ontology [8] que almacena una ontolog´ıa de genes basada en sus procesos biol´ ogicos, funciones moleculares y componentes celulares. Este cap´ıtulo se dividir´ a en varias secciones siguiendo el esquema utilizado en el Cap´ıtulo 3. Se comenzar´ a con una introducci´ on al problema desde el punto de vista biol´ ogico, para luego mostrar en detalle los pasos realizados para aplicar la metodolog´ıa al problema tratado. Finalmente, se realizar´ a una evaluaci´ on de los resultados obtenidos, tanto desde el punto de vista computacional como desde el experimental.

5.1.

Introducci´ on al problema biol´ ogico

La metodolog´ıa introducida en el Cap´ıtulo 3 se aplicar´ a en este cap´ıtulo a un problema sobre organismos eucariotas. Este problema consiste en el estudio de la respuesta inflamatoria de seres humanos al aplicarles una endotoxina en forma intravenosa, en comparaci´ on con un grupo de control al cual se le inyecta un placebo [79]. En este estudio, se han extra´ıdo un conjunto de genes de la sangre de los ocho pacientes tratados, cuatro con la endotoxina (pacientes 1-4) 127

128

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

20000 15000 10000 5000 0

Nivel de expresi´ on

25000

y cuatro con el placebo (pacientes 5-8). Los datos se han extra´ıdo en diferentes instantes de tiempo, a 0, 2, 4, 6, 9 y 24 horas, y se han procesado utilizando R R . Del estudio de los perfiles y HG-U133A v2.0 de Affymetrix Inc GeneChips de expresi´ on de la sangre de los pacientes, podemos extraer y representar gr´ aficamente la informaci´ on sobre la expresi´ on en el tiempo de cada uno de los genes. En la Figura 5.1 se muestra un ejemplo de esta clase de gr´ aficos de expresi´ on en el tiempo. Es necesario hacer notar que s´ olo los cuatro pacientes tratados con la endotoxina intravenosa est´ an representados en la figura, y sus series temporales han sido organizadas consecutivamente resultando en gr´ aficos con una distribuci´ on regular. Estas series temporales se han agrupado en 24 clusters utilizando el algoritmo de clustering cl´ asico k-medias [36], resultando en los 24 gr´ aficos de la Figura 5.2.

0 2 4 6 9 24 0 2 4 6 9 24 0 2 4 6 9 24 0 2 4 6 9 24 | {z }| {z }| {z }| {z } P aciente 1 P aciente 2 P aciente 3 P aciente 4

Hora Figura 5.1: Gr´ afica de la serie temporal correspondiente a la expresi´ on de un conjunto de genes en el tiempo. El eje X corresponde a la hora en que se toma la medici´ on, mientras que el eje Y corresponde al nivel de expresi´ on detectado. Notar que solamente se representa la informaci´ on de los cuatro pacientes a los cuales se les ha inyectado la endotoxina en forma sucesiva, obteniendo una gr´ afica con una distribuci´ on regular. Adem´ as de la informaci´ on sobre la expresi´ on en el tiempo de los distintos genes utilizados en este estudio, se cuenta con informaci´ on sobre varias caracter´ısticas que presentan estos mismos genes. Estas caracter´ısticas pueden clasificarse en tres grandes grupos: funci´ on molecular, participaci´ on en alg´ un proceso

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

´ AL PROBLEMA BIOLOGICO ´ 5.1. INTRODUCCION 129

Figura 5.2: Clusters de los datos de expresi´ on. Este agrupamiento ha sido realizado utilizando el algoritmo k-means con k = 24.

0

130

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

biol´ ogico y lugar en el organismo donde se encuentra presente el gen. Esta inR y formaci´ on se extrae de la base de datos HG-U133A v2.0 de Affymetrix Inc las anotaciones de cada gen corresponden a la ontolog´ıa de genes definida como parte del proyecto “Gene Ontology” [8]. El objetivo de este cap´ıtulo es mostrar la aplicaci´ on de la metodolog´ıa propuesta al estudio biol´ ogico de respuesta inflamatoria en seres humanos con el fin de descubrir conceptos de clusters basados u ´nicamente en los datos de las propiedades de los genes, sin hacer uso de la informaci´ on de expresi´ on. De esta manera, nos permitir´ a comprender mejor el por qu´e cierto conjunto de genes se comportan de forma similar, es decir, se expresan manteniendo el mismo esquema. A este problema o dominio lo llamaremos ontolog´ıa de genes o´ simplemente GO. Como ya se ha mencionado, una de las bases de datos con la cual se trabajar´ a en esta aplicaci´ on es parte del proyecto “Gene Ontology”, GO. El objetivo de este proyecto es producir un vocabulario controlado que pueda aplicarse a todos los organismos, a´ un cuando el conocimiento sobre los roles de los genes y las prote´ınas en las c´elulas siga acumul´ andose y cambiando continuamente. En la actualidad, los bi´ ologos gastan mucho tiempo y esfuerzo en buscar toda la informaci´ on disponible acerca de una peque˜ na a´rea de investigaci´ on sobre la cual est´en trabajando. Esta b´ usqueda es obstaculizada por la gran variabilidad en la terminolog´ıa que se est´e utilizando en un momento de tiempo determinado, es decir, dependiendo de ´esta, los resultados de la b´ usqueda ser´ an diferentes. Esto prohibe una b´ usqueda efectiva, tanto por parte de los seres humanos, como por parte de los ordenadores. Por ejemplo, si se est´ an buscando nuevos objetivos para antibi´ oticos, podr´ıamos necesitar todos los genes que est´en involucrados en la s´ıntesis de prote´ınas de bacterias y que tengan adem´ as secuencias o estructuras significativamente diferentes de aquellas en humanos. Pero, si una base de datos describe estas mol´eculas como involucradas en la “traducci´ on”, mientras que otra utiliza la frase “s´ıntesis de prote´ınas”, ser´ a muy dificultoso para el usuario –y a´ un mas dif´ıcil para un ordenador– encontrar t´erminos con una funcionalidad equivalente. El uso de los t´erminos de GO por varias bases de datos facilita la uniformidad de las consultas. Los vocabularios est´ an estructurados de tal manera que se puede consultar a diferentes niveles. Por ejemplo, se puede usar GO para buscar todos los genes en el genoma del rat´ on que est´en involucrados en la transducci´ on de se˜ nales1 , o se puede buscar, en forma m´ as espec´ıfica, todos los receptores tirosina-kinasa2 . Esta estructura tambi´en permite realizar anotaciones sobre propiedades de genes en diferentes niveles, dependiendo del conocimiento que se 1 Conjunto de procesos o etapas que ocurren de forman concatenada por el que una c´ elula convierte una determinada se˜ nal o est´ımulo exterior, en otra se˜ nal o respuesta espec´ıfica. 2 Una tirosina-kinasa es una enzima que puede transferir un grupo fosfato a una tirosina en una prote´ına. Estas enzimas son una subclase de una clase de prote´ınas kinasa m´ as amplia. La fosforilaci´ on es una funci´ on importante en la transducci´ on de se˜ nales para regular una actividad enzim´ atica.

´ AL PROBLEMA BIOLOGICO ´ 5.1. INTRODUCCION

131

tenga de los mismos. Es importante notar que GO no es una base de datos de secuencias de genes, como puede ser GenBank [16] o EMBL [55], y tampoco un cat´ alogo de genes. Por el contrario, GO describe c´ omo se comportan los genes en un contexto celular. Por otro lado, GO no intenta describir cada aspecto de la biolog´ıa. Por ejemplo, la estructura de dominio, la estructura 3D, la evoluci´ on y la expresi´ on gen´etica de una prote´ına, no est´ an contenidas en la base de datos de GO. Se est´ an desarrollando tres vocabularios (ontolog´ıas) estructurados y controlados para describir los genes en t´erminos de sus procesos biol´ ogicos asociados, componentes celulares y funciones moleculares, independientemente de las especies biol´ ogicas. Un gen puede tener una o m´ as funciones moleculares, ser utilizado en uno o m´ as procesos biol´ ogicos y estar asociado a uno o m´ as componentes celulares. Por ejemplo, el gen citocromo c puede describirse por los t´erminos “matriz mitocondrial” y “membrana mitocondrial interna”.

5.1.1.

Las diferentes ontolog´ıas

Como ya se ha mencionado, las tres organizaciones principales de GO son funci´ on molecular, proceso biol´ ogico y componente celular. A continuaci´ on analizaremos en detalle cada una de ellas: Funci´ on Molecular: esta ontolog´ıa abarca aquellas tareas desarrolladas por genes individuales. La funci´ on molecular describe actividades, tales como actividades catal´ıticas o de binding, a nivel molecular. Los t´erminos de funciones moleculares de GO representan actividades y no entidades, como mol´eculas o complejos, que realizan acciones y no especifican d´ onde, ni cu´ ando, ni en qu´e contexto se lleva a cabo la acci´ on. Las funciones moleculares generalmente corresponden a actividades que pueden ser realizadas por genes individuales, pero algunas actividades son realizadas por complejos ensamblados de genes. Ejemplos de t´erminos de funcionalidad general son las actividades “catal´ıticas”, actividades de “transporte”, o “binding”. Ejemplos de t´erminos funcionales m´ as espec´ıficos son la actividad de adenilato ciclasa o el binding del receptor toll. Es f´ acil confundir un producto de un gen con su funci´ on molecular debido a que, en muchas ocasiones, se describen con exactamente las mismas palabras. Por ejemplo, “alcohol dehidrogenasa” puede describir lo que se puede colocar en un tubo Eppendorf (el producto del gen) o la funci´ on de ´este. Sin embargo, existe una diferencia formal: un producto de un gen simple puede tener varias funciones moleculares, y muchos genes pueden compartir la misma funci´ on molecular. Por ejemplo, existen muchos genes con la funci´ on “alcohol dehidrogenasa”, y s´ olo algunos de ´estos, pero no todos, pueden ser codificados por genes con el nombre alcohol dehidrogenasa.

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

132

Un producto de un gen particular puede tener tanto la funci´ on “alcohol dehidrogenasa” como “acetaldehido dismutasa”, y tal vez tambi´en otras funciones. Es importante comprender que, cuando se usen t´erminos como “actividad de alcohol dehidrogenasa” en GO, esto corresponde a la funci´ on y no a la entidad. Es por esta raz´ on que muchas funciones moleculares de GO tienen agregadas la palabra “actividad”. Proceso biol´ ogico: esta ontolog´ıa comprende objetivos biol´ ogicos, tales como la mitosis o el metabolismo de purinas, que son realizados por funciones moleculares. Un proceso biol´ ogico es llevado a cabo por uno o m´ as ensamblajes ordenados de funciones moleculares. Ejemplos de t´erminos de procesos biol´ ogicos de amplio espectro son “crecimiento y mantenimiento” o “transducci´ on de se˜ nales”. Ejemplos de t´erminos m´ as espec´ıficos son “metabolismo de pirimidinas” o “transporte de alfa-glucosidasa”. Puede ser dif´ıcil distinguir entre proceso biol´ ogico y funci´ on molecular, pero la regla general es que los procesos deben tener m´ as de un paso distintivo. Esto no debe confundirse con un camino o pathway. Componente celular: esta ontolog´ıa cubre estructuras subcelulares, localizaciones y complejos macromoleculares. Un componente celular es simplemente lo que su nombre indica, un componente de la c´elula, a condici´ on de que sea parte de alg´ un objeto mayor, el cual puede ser una estructura anat´ omica (ret´ıculo endoplasm´ atico rugoso o n´ ucleo) o un grupo de genes (ribosoma, proteasoma o d´ımero proteico). Ejemplos de t´erminos de esta ontolog´ıa son “n´ ucleo” y “tel´ omero”.

5.1.2.

Estructura de las ontolog´ıas

Los t´erminos GO est´ an organizados en estructuras llamadas grafos dirigidos ac´ıclicos (GDAs) [3], que son diferentes a una jerarqu´ıa en la que un “hijo”, es decir, un t´ermino m´ as especializado, puede tener varios “padres”, es decir, t´erminos menos especializados. Por ejemplo, el proceso biol´ ogico “bios´ıntesis de hexosa” tiene dos padres, “metabolismo de hexosa” y “bios´ıntesis de monosac´ aridos”. Esto es debido a que es un subtipo de metabolismo y a que una hexosa es un tipo de monosac´ arido. Cualquier gen involucrado en la bios´ıntesis de hexosa anotado con este t´ermino, tambi´en es autom´ aticamente anotado tanto a “metabolismo de hexosa” como con “bios´ıntesis de monosac´ aridos”. Esto es debido a que cada t´ermino de GO obedece la regla del camino verdadero 3 : si el t´ermino hijo describe un producto de un gen, tambi´en todos sus t´erminos padre deben aplicar a ese producto. Se dice entonces que un nodo de GO, es decir un nodo del GDA, se refiere al t´ermino indicado en particular y a todos sus padres. 3 La regla del camino verdadero define que “el camino desde un t´ ermino hijo hasta su/s padre/s en el nivel m´ as alto debe ser verdadero”.

´ AL PROBLEMA BIOLOGICO ´ 5.1. INTRODUCCION

133

Las tres ontolog´ıas est´ an unidas entre s´ı por el t´ermino de GO 0003673, llamado “Gene Ontology”. Todo t´ermino de GO tiene como ancestro a ´este t´ermino, sea cual sea su tipo (componente celular, funci´ on molecular o proceso biol´ ogico). Este t´ermino no representa ning´ un concepto biol´ ogico real y ha sido declarado como obsoleto y reemplazado por un nodo artificial, que no pertenece a ninguna de las ontolog´ıas, llamado “all” (todo), el cual constituye el t´ermino m´ as general posible. Un t´ermino hijo puede tener una de dos posibles relaciones con su/s padre/s: “es un” o “es parte de” (ver Figura 5.3). Un mismo t´ermino puede tener diferentes relaciones con diferentes padres. T´ermino GO 2

T´ermino GO 1

es un

es parte de T´ermino GO 3

Figura 5.3: Relaciones entre t´erminos de GO La relaci´ on “es un” significa que un t´ermino es una subclase de sus padres. Por ejemplo, “ciclo de una c´elula mit´ otica” es un “ciclo de una c´elula”. No debe confundirse con una instancia, la cual es un ejemplo espec´ıfico. La relaci´ on “es un” es transitiva, lo cual significa que si un t´ermino GO A es una subclase del t´ermino GO B, y el t´ermino GO B es una subclase del t´ermino GO C, entonces el t´ermino GO A es tambi´en una subclase del t´ermino GO C. as compleja. Existen cuatro niveles b´ asicos de La relaci´ on “es parte de” es m´ restricciones para una relaci´ on “es parte de”: Concepto padre necesariamente es parte de y necesariamente necesariamente tiene parte en tiene parte en es parte de no hay necesidad

(1)

(2)

(3)

(4)

Concepto hijo El primer tipo (1) no tiene restricciones. Esto es, no se puede realizar otra inferencia de la relaci´ on entre padre e hijo aparte de que el padre pueda

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

134

o no tener al hijo como parte de ´el, y que el hijo pueda o no ser parte del padre. El segundo tipo (2) significa que, cuando el hijo existe, obligatoriamente es parte del padre. Por ejemplo, “bifurcaci´ on de una r´eplica” es parte de “cromosoma”. Por lo tanto, cuando una “bifurcaci´ on de una r´eplica” ocurre, entonces es parte de “cromosoma”; pero “cromosoma” no necesariamente tiene una “bifurcaci´ on de una r´eplica”. El tercer tipo (3) es exactamente la inversa del tipo (2): cuando un padre existe, tiene al hijo como parte, pero no necesariamente el hijo es parte del padre. Por ejemplo, “n´ ucleo” siempre es parte de “cromosoma”, pero “cromosoma” no es necesariamente parte de “n´ ucleo”. El cuarto tipo (4) es la combinaci´ on de los casos (2) y (3). Un ejemplo de ´este caso es “membrana nuclear” que es parte de “n´ ucleo”. Por ello, “n´ ucleo” siempre tiene parte en “membrana nuclear” y “membrana nuclear” siempre es parte de “n´ ucleo”. La relaci´ on “es parte de” utilizada en GO es generalmente del segundo tipo (2), “necesariamente es parte de”. Notar que los tipos (1) y (3) no se utilizan en GO, ya que violar´ıan la regla de camino verdadero. Al igual que “es un”, “es parte de” es transitiva, de tal manera que si un t´ermino GO A es parte del t´ermino GO B, y el t´ermino GO B es parte del t´ermino GO C, entonces el t´ermino GO A es tambi´en es parte del t´ermino GO C.

5.1.3.

Formato de las anotaciones utilizando GO

Cada gen se anota con uno o varios c´ odigos de GO de una o varias de sus ontolog´ıas. Adicionalmente, cada uno de estos t´erminos tiene asociado un c´ odigo de evidencia, que determina de qu´e manera se ha obtenido la relaci´ on entre el t´ermino y el gen. Ejemplos de evidencia pueden ser IC (inferido por un curador) y TAS (declaraci´ on detectable de un autor, lo cual puede ser a trav´es de un experimento publicado en un art´ıculo de revista o en un libro de texto o diccionario). En la Figura 5.4 se puede ver una porci´ on de una entrada de la base de datos de GenBank de un producto de un gen donde se pueden apreciar las anotaciones de GO asociadas. Por ejemplo, esta prote´ına tiene la funci´ on molecular “actividad oxidoreductasa”, que corresponde al c´ odigo de GO 0016491, y la evidencia IEA (inferido de una anotaci´ on electr´ onica, lo que quiere decir que no ha sido verificada por un curador).

´ DE LA BASE DE DATOS ESTRUCTURADA 5.2. CONSTRUCCION

LOCUS DEFINITION ACCESSION VERSION DBSOURCE KEYWORDS SOURCE ORGANISM

REFERENCE AUTHORS TITLE JOURNAL PUBMED REMARK

NP_001082 751 aa linear PRI 26-OCT-2004 amiloride binding protein 1 precursor [Homo sapiens]. NP_001082 NP_001082.1 GI:4501851 REFSEQ: accession NM_001091.1 . Homo sapiens (human) Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. 1 (residues 1 to 751) Olive,M., Unzeta,M., Moreno,D. and Ferrer,I. Overexpression of semicarbazide-sensitive amine oxidase in human myopathies Muscle Nerve 29 (2), 261-266 (2004) 14755492 GeneRIF: Semicarbazide-sensitive amine oxidase is a source of oxidative stress in diseased human skeletal muscle; it contributes to oxidative stress-induced damage in various inflammatory and other myopathies.

... FEATURES source

Protein

sig_peptide mat_peptide CDS

Location/Qualifiers 1..751 /organism="Homo sapiens" /db_xref="taxon:9606" /chromosome="7" /map="7q34-q36" 1..751 /product="amiloride binding protein 1 precursor" /EC_number="1.4.3.6" /note="diamine oxidase; Amiloride-binding protein-1" 1..19 20..751 /product="amiloride-binding protein 1" 1..751 /gene="APB1" /coded_by="NM_001091.1:72..2327" /note="go_component: peroxisome [goid 0005777] [evidence NAS] [pmid 1356107]; go_function: drug binding [goid 0008144] [evidence NR]; go_function: heparin binding [goid 0008201] [evidence IEA]; go_function: copper ion binding [goid 0005507] [evidence IEA]; go_function: oxidoreductase activity [goid 0016491] [evidence IEA]; go_function: amine oxidase activity [goid 0008131] [evidence TAS] [pmid 8144586]; go_process: metabolism [goid 0008152] [evidence NR]" /db_xref="GeneID:26" /db_xref="MIM:104610"

ORIGIN 1 mpalgwavaa ilmlqtamae pspgtlprka gvfsdlsnqe lkavhsflws kkelrlqpss 61 tttmakntvf liemllpkky hvlrfldkge rhpvrearav iffgdqehpn vtefavgplp ... 721 ngpnyvqrwi pedrdcsmpp pfsyngtyrp v //

Figura 5.4: Ejemplo de anotaci´ on de GO

135

136

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

Nombre 206621_s_at

Proceso biol´ ogico GO:0006446

Funci´ on molecular GO:0003723 GO:0003743

Componente celular GO:0016281

(a) Instancia

GO:0003673 GO:0008150

GO:0003674

GO:0005575

···

GO:0007154

···

GO:0006446

···

GO:0016281

GO:0005488 ···

···

GO:0003723

GO:0003743

(b) Representaci´ on estructurada

Figura 5.5: Ejemplo de la representaci´ on de una instancia. Los nodos de color celeste corresponden a la ontolog´ıa de proceso biol´ ogico, los verdes a la ontolog´ıa de funci´ on molecular y los rosas a la ontolog´ıa de componente celular. Los puntos suspensivos reemplazan a uno o varios niveles. Por ejemplo, el nodo GO:0003723 est´ a en realidad mucho m´ as cercano a la ra´ız del a´rbol que el nodo GO:0003743.

5.2.

Construcci´ on de la base de datos estructurada

La base de datos en bruto con que se trabajar´ a en esta aplicaci´ on de la metodolog´ıa propuesta consiste en el grupo de genes extra´ıdos de la sangre de los pacientes del estudio, indicados por sus c´ odigos en la base de datos de Affymetrix, como pueden ser: {200008_s_at, 201011_at, 201352_at, etc.}. La construcci´ on de la nueva base de datos estructurada requiere buscar las anotaciones de GO correspondientes a cada una de las instancias de la base de datos en bruto. El modelado de los objetos es directo, ya que contamos con las ontolog´ıas de GO,

´ AL DOMINIO DE ONTOLOG´ 5.3. APLICACION IA DE GENES

137

las cuales son bases de datos estructuradas. Cada instancia de la base de datos tiene uno o varios c´ odigos de GO correspondientes a una o varias de las tres ontolog´ıas posibles. En la Figura 5.5(a) se muestra un ejemplo de una instancia de la base de datos. El modelado propuesto para este dominio consiste en incorporar el conocimiento de las jerarqu´ıas de GO en cada instancia de tal manera que el algoritmo de clustering conceptual pueda hacer uso de esta informaci´ on. Para ello, a cada c´ odigo de GO al cual pertenezca una instancia se le incorporar´ a la informaci´ on de sus ancestros desde su/s padre/s hasta la ra´ız de GO. En la Figura 5.5(b) se muestra la representaci´ on estructurada de la instancia de la Figura 5.5(a) utilizando las jerarqu´ıas de GO. Esta representaci´ on estructurada de cada instancia conformar´ a la nueva base de datos de objetos estructurados que servir´ a de entrada al algoritmo de clustering conceptual. Como se puede ver en la figura, nuevamente contamos con una representaci´ on en forma de a´rbol.

5.3.

Adaptaci´ on de CC-EMO para su aplicaci´ on al dominio de ontolog´ıa de genes

Para poder aplicar el algoritmo CC-EMO a este nuevo dominio, es necesario primero realizar algunas modificaciones sencillas. Uno de los cambios necesarios es la codificaci´ on de los cromosomas del algoritmo evolutivo. Una opci´ on posible consiste en mantener la misma estructura, en forma de a´rbol, de la base de datos, tal como se hac´ıa en el dominio geom´etrico del Cap´ıtulo 3. Si bien esto es viable y sencillo de realizar, es mucho m´ as eficiente computacionalmente codificar los cromosomas como un vector de c´ odigos de GO y mantener las jerarqu´ıas almacenadas de forma externa. De esta manera se ahorra mucho espacio en la representaci´ on, ya que no es necesario repetir parte de la jerarqu´ıa de GO en cada cromosoma. Cuando sea necesario utilizar esta informaci´ on, se acceder´ aa ella como se explicar´ a m´ as adelante. Entonces, para la representaci´ on de un cromosoma se utilizar´ a un vector de nodos, que podr´ an ser de tres tipos: nodos tipo 1 (correspondientes a los posibles nodos de la jerarqu´ıa de GO de procesos biol´ ogicos), nodos tipo 2 (correspondientes a funci´ on molecular) y nodos tipo 3 (correspondientes a componente celular). Cada uno de estos nodos tiene asociada una etiqueta, la cual restringir´ a la aplicaci´ on de los operadores gen´eticos, tal como se ha explicado en la Secci´ on 3.4. Al utilizar una representaci´ on lineal, en contraposici´ on con la representaci´ on jer´ arquica del cap´ıtulo anterior, trabajaremos con un AG en lugar de un algoritmo de PG. En las primeras pruebas de CC-EMO utilizando este nuevo dominio, las implementaciones cl´ asicas de los objetivos de especificidad y sensibilidad como tama˜ no y soporte, respectivamente, devolvieron resultados sub´ optimos. Las subestructuras obtenidas conten´ıan descripciones de GO que se encontraban muy altas en la jerarqu´ıa y, por lo tanto, eran muy generales y poco u ´tiles para resol-

138

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

ver el problema. Debido a esto, y luego de un estudio detallado de ambos objetivos, se lleg´ o a la conclusi´ on de que el objetivo de especificidad no funcionaba correctamente al no tener en cuenta la informaci´ on de los niveles de la jerarqu´ıa de GO. La raz´ on por la cual el tama˜ no de la subestructura no redundaba en buenos resultados era que, en este dominio, la especificidad de la subestructura no es linealmente dependiente a su tama˜ no. Como ejemplo de esta situaci´ on ilustramos dos subestructuras en la Figura 5.6: la Subestructura1 de la Figura 5.6(a) tiene tama˜ no 2 (debido a que se tienen dos nodos en la representaci´ on del cromosoma correspondientes a las hojas del a´rbol), y la Subestructura 2 de la Figura 5.6(b) con tama˜ no 1. Ambas subestructuras cubren la instancia de la Figura 5.6(c), pero la Subestructura1 es m´ as general que la Subestructura2 , a´ un cuando la Subestructura1 es m´ as grande que la Subestructura2 en tama˜ no. Se dice que una subestructura cubre una instancia si la subestructura es un a´rbol prefijo de la instancia: Un a´rbol T 0 es un a ´rbol prefijo de T , si T puede obtenerse incorporando cero o m´ as a´rboles a algunos nodos de T 0 . Notar que cualquier a´rbol T es prefijo de s´ı mismo. En la Figura 5.6, se puede ver que la subestructura Subestructura1 es un a´rbol prefijo de la instancia, y que la Subestructura 2 es igual a la instancia. Por lo tanto, tambi´en es un a´rbol prefijo. Esta definici´ on es muy similar a la mencionada en la Secci´ on 3.4, pero exige que la relaci´ on de inclusi´ on del a´rbol correspondiente a la subestructura en el a´rbol instancia comience desde la ra´ız. Por lo tanto, el objetivo de especificidad debe reformularse bas´ andose no s´ olo en el tama˜ no de la subestructura, sino tambi´en en los niveles de los t´erminos de GO dentro de las tres ontolog´ıas. Para ello, comparamos los niveles cada nodo de la subestructura en la jerarqu´ıa de GO, contra su nodo correspondiente en cada instancia de la base de datos cubierta por la subestructura. Veamos un ejemplo: supongamos que contamos con la subestructura de la Figura 5.6(a) y una de las instancias cubiertas por esta subestructura es la de la Figura 5.6(c). Para calcular el nivel de especificidad de la subestructura, debemos comparar cada nodo que la compone con respecto a su correspondiente nodo asociado en la instancia. La subestructura tiene dos nodos hoja {GO:0005886,GO:0016021} al igual que la instancia {GO:0005886,GO:0005639}. El nodo GO:0005886 cubre al nodo GO:0005886 de la instancia, por lo que estos nodos est´ an asociados en el c´ alculo de especificidad. Lo mismo sucede con el nodo GO:0016021 de la subestructura y el nodo GO:0005639 de la instancia. Recordar que la informaci´ on de nivel de cada nodo y su termino GO asociado reflejan la especificidad de cada t´ermino. Cuanto mayor sea el valor del nivel, m´ as espec´ıfica es la informaci´ on del nodo. En el ejemplo, los nodos GO:0005886 y GO:0016021 son de nivel 4, mientras que el nodo GO:0005639 es de nivel 5, seg´ un la jerarqu´ıa de GO. Para poder reflejar esta informaci´ on en el nuevo objetivo de especificidad, realizaremos

´ AL DOMINIO DE ONTOLOG´ 5.3. APLICACION IA DE GENES GO:0003673 (0)

GO:0003673 (0)

GO:0005575 (1)

GO:0005575 (1)

···

···

GO:0005886 (4)

···

···

GO:0016021 (4)

GO:0016021 (4)

139

GO:0005639 (5)

(a) Subestructura1

(b) Subestructura2 GO:0003673 (0)

GO:0005575 (1)

···

···

···

GO:0005886 (4)

GO:0016021 (4)

GO:0005639 (5)

(c) Instancia

Figura 5.6: Ejemplo de subestructuras que cubren una misma instancia. Los n´ umeros entre par´entesis corresponden al nivel del nodo en la jerarqu´ıa de GO.

una suma ponderada calculada por la ecuaci´ on 5.1: P#instancias cubiertas i=1

Especif icidad(x) =

1−

P#nodosinstanciai j=1

nivel relativo(x)j i nivel absolutoj i

#nodosinstanciai

!

#instancias cubiertas

(5.1) donde nivel relativo(x)ji es la diferencia de niveles entre el nodo j, de la instancia i, y su nodo asociado en la subestructura (x); y nivel absoluto ji es el nivel absoluto del nodo j de la instancia i en la jerarqu´ıa de GO. Podemos inferir de la ecuaci´ on 5.1 que, cuanto m´ as grande sea el nivel de separaci´ on de los nodos

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

140

de la subestructura a los nodos de la instancia, mayor ser´ a el valor de la f´ ormula nivel relativo(x)ji . Por lo tanto, la penalizaci´ o n por una baja especificidad ser´ a nivel absolutoji mayor, produciendo un valor menor al rest´ arselo a uno. Recordar que los objetivos del algoritmo CC-EMO se maximizan. La f´ ormula de especificidad se normaliza para producir un valor de objetivo entre cero y uno. Aplicando la ecuaci´ on 5.2 a nuestro ejemplo, tenemos el siguiente c´ alculo de la especificidad:   P#nodos ! P nivel relativo(x) 1 −

j=1

instanciai

ji

nivel absolutoji

#nodosinstanciai

=

1−

1 1 j=1 5

1

= 0,8

(5.2)

Notar que, dado que hay dos posibles nodos en la subestructura que cubren al mismo nodo en la instancia, se realiza el c´ alculo para ambas alternativas y luego se promedia. El c´ alculo de especificidad se realiza para todas las instancias cubiertas por la subestructura. Por ejemplo, el a´rbol de la Figura 5.6(b) tiene un valor de especificidad de 0,0870057 calculado sobre 154 instancias de la base cubiertas por la subestructura que representa.

5.4.

Evaluaci´ on de los clusters generados

La base de datos utilizada para este dominio, extra´ıda del experimento introducido en la Secci´ on 5.1, est´ a compuesta por 1770 instancias de genes y sus t´erminos GO asociados. La poblaci´ on inicial de CC-EMO est´ a formada por un 50 % de sub´ arboles elegidos aleatoriamente de la base de datos y un 50 % de instancias completamente aleatorias generadas a partir de la jerarqu´ıa de GO. Este procedimiento particular fue necesario debido a que no todos los t´erminos de GO aparec´ıan en la base de datos de entrada, haciendo m´ as dificil que el algoritmo encontrara buenas soluciones contando solamente con los t´erminos de la base de datos original. Los par´ ametros de los algoritmos utilizados para este dominio se muestran en la Tabla 5.1. El algoritmo CC-EMO se ha ejecutado 10 veces utilizando distintas semillas y el promedio de estas ejecuciones es el que se considerar´ a a partir de ahora. En la Figura 5.7 se muestran las soluciones Pareto obtenidas por cada uno de los algoritmos utilizados (APRIORI, SUBDUE y CC-EMO). Es necesario recordar que el conjunto Pareto para CC-EMO est´ a compuesto de la uni´ on de las soluciones para las 10 ejecuciones del algoritmo y que los frentes de Pareto requieren la misma explicaci´ on dada en la Secci´ on 3.5. Se puede ver en estos gr´ aficos que APRIORI y SUBDUE obtienen un n´ umero limitado de soluciones. En el caso particular de APRIORI, dicho algoritmo encuentra alguna de las soluciones o´ptimas considerando solamente el objetivo de

´ DE LOS CLUSTERS GENERADOS 5.4. EVALUACION

141

Valor 200 20000 0,6 0,2

Par´ ametro Tama˜ no de la poblaci´ on N´ umero de evaluaciones Probabilidad de cruce Probabilidad de mutaci´ on

Tabla 5.1: Par´ ametros para el dominio de ontolog´ıa de genes

sensibilidad. Esto es debido a que, a pesar que el algoritmo APRIORI no ha sido dise˜ nando para trabajar con bases de datos estructuradas, la transformaci´ on de la base de datos a este sistema ha sido la apropiada. En el caso de SUBDUE, ´este encuentra correctamente las mejores soluciones para los objetivos de especificidad y sensibilidad por separado, es decir, descubre los extremos del frente de Pareto, pero no puede llegar a encontrar buenas soluciones de compromiso por las mismas razones comentadas en la Secci´ on 3.5. Finalmente, el conjunto Pareto para CC-EMO contiene la mayor´ıa de las soluciones encontradas por los sistemas APRIORI y SUBDUE, y adem´ as una gran diversidad de soluciones de compromiso. 1

1

0.8

0.4

0.2

0

0.8

+

0.6

SOPORTE

+

0.6

SOPORTE

SOPORTE

0.8

1

0.4

0.2

0

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

0

Funci´ on molecular

0

Componente celular GO:0005575 cellular component (level: 1)

(d) Subestructura en com´ un

0.4

0.2

(a) APRIORI

Proceso biol´ ogico

+

0.6

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

(b) SUBDUE

0

+ 0

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

(c) CC-EMO

Proceso biol´ ogico GO:0008151 cell growth and/or maintenance (level: 4)

Funci´ on molecular GO:0005488 binding

Componente celular GO:0016020 membrane

(level: 2)

(level: 3) GO:0000267 cell fraction (level: 3)

(e) Ejemplo destacado

Figura 5.7: Frentes de Pareto para el dominio de ontolog´ıa de genes.

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

142

CC

1

SOPORTE

0.8

0.6

0.4

PB

FM

0.2

0

0

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

(a) APRIORI CC

1

SOPORTE

0.8

0.6

0.4

PB

FM

0.2

0

0

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

(b) SUBDUE CC

1

SOPORTE

0.8

0.6

0.4

PB

FM

0.2

0

0

0.1

0.2

0.3 0.4 0.5 ESPECIFICIDAD

0.6

0.7

0.8

(c) CC-EMO

Figura 5.8: Espacio de objetivos vs. espacio de variables de cada conjunto Pareto.

´ DE LOS CLUSTERS GENERADOS 5.4. EVALUACION

APRIORI SUBDUE CC-EMO prom. (desv est)

S(X) 1,8517 2,4952 4,2983 (0 , 7194 )

143

M∗ 3 1,1853 1,1978 1,2334 (0 , 0047 )

(a) M´ etricas S y M∗3

APRIORI SUBDUE CC-EMO prom. (desv est)

M∗ 2 6 17,56 186,8680 (12 , 2065 )

|X| 7 19 188 (12 , 19 )

(b) M´ etrica M∗2

C(X 0 , X 00 ) APRIORI SUBDUE CC-EMO prom. (desv est)

APRIORI 0,00 0,00 (0 , 00 )

SUBDUE 0,00 0,08421 (0 , 04438 )

CC-EMO prom. (desv est) 0,00000 (0 , 0000 ) 0,00050 (0 , 0016 ) -

(c) M´ etrica C

N D(X 0 , X 00 ) APRIORI SUBDUE CC-EMO prom. (desv est)

APRIORI 13 181,80 (11 , 99 )

SUBDUE 1 171,80 (11 , 62 )

CC-EMO prom. (desv est) 1,20 (0 , 42 ) 1,60 (1 , 17 ) -

(d) M´ etrica N D

Tabla 5.2: Resultado de las m´etricas para los distintos algoritmos en el dominio de ontolog´ıa de genes.

Adicionalmente, en la Figura 5.8 se muestran el espacio de variables y el de los objetivos de los conjuntos Pareto de cada algoritmo. El eje PB corresponde a la ontolog´ıa de proceso biol´ ogico y crece a medida que aumenta el nivel de los c´ odigos de GO de la descripci´ on asociada en su respectiva jerarqu´ıa. An´ alogamente, FM corresponde a funci´ on molecular y CC a componente celular. Si, por ejemplo, una descripci´ on tiene asociada dos c´ odigos de GO, uno de nivel 6 de PB y uno de nivel 2 de CC, entonces se graficar´ a una esfera en la posici´ on (PB=6,FM=0,CC=2) con un radio del tama˜ no correspondiente a la cantidad de instancias que cubre de la base de datos. Es interesante ver que APRIORI s´ olo descubre aquellas soluciones que se encuentran sobre los ejes del gr´ afico, mientras que el SUBDUE logra extraer algunas que tengan m´ as de un c´ odigo

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

165

4.0

170

1.235

175

4.5

180

1.240

185

5.0

190

5.5

195

1.245

200

144

(a) S

(b) M∗2

(c) M∗3

Figura 5.9: Boxplots de las m´etricas S, M∗2 y M∗3 para CC-EMO en el dominio de ontolog´ıa de genes.

en distintas jerarqu´ıas de GO. Por u ´ltimo, CC-EMO es el enfoque que logra obtener no s´ olo las soluciones sobre los ejes, sino tambi´en una amplia variedad de soluciones con diferentes niveles y que involucran a m´ as de una de las jerarqu´ıas de GO. Para verificar estos u ´ltimas afirmaciones, emplearemos un conjunto de las m´etricas presentadas en la Secci´ on 2.5.3. Comenzaremos estudiando las m´etricas para conjuntos de Pareto individuales. En la Tabla 5.2 se muestran todos los resultados para M∗2 , M∗3 y S. Por otro lado, los boxplots asociados a cada una de ellas para CC-EMO ilustran en la Figura 5.9. La m´etrica M∗2 muestra la diversidad de soluciones encontradas en un conjunto Pareto, y como se observa en la Tabla 5.2(b), CC-EMO es claramente el algoritmo con mejor diversidad de soluciones. Este hecho tambi´en puede verse en los frentes de Pareto de la Figura 5.7. La m´etrica M∗3 muestra como CC-EMO est´ a cubriendo correctamente los extremos del frente de Pareto, seguido por SUBDUE y finalmente APRIORI, como puede verse en la Tabla 5.2(a) y en la Figura 5.7. Finalmente, para la m´etrica S, recogida en la Tabla 5.2(a) y en la Figura 5.9, CC-EMO obtiene el valor m´ as alto, cubriendo mejor el espacio del frente del Pareto. Ahora estudiaremos las m´etricas de comparaci´ on. Con respecto a la m´etrica C, como puede verse en la Tabla 5.2(c) y la Figura 5.10(a), no hay ninguna soluci´ on de CC-EMO que sea dominada por APRIORI y, a su vez, APRIORI no domina a los otros dos algoritmos, mientras que SUBDUE s´ olo descubre una soluci´ on que domina al conjunto Pareto de CC-EMO. La m´etrica N D muestra en la Tabla 5.2(d) y la Figura 5.10(b), que CC-EMO descubre m´ as soluciones no dominadas que los otros dos algoritmos. APRIORI y SUBDUE encuentran muy pocas soluciones que CC-EMO no llega a obtener (1,20 y 1,60 en promedio de la Tabla 5.2(d)). La diferencia de valores en la m´etrica N D para CC-EMO

´ DE LA BASE DE DATOS 5.5. COMPACTACION

145

en contraste con APRIORI y SUBDUE (181,89 y 171,80 vs. solamente 1,20 y 1,60 de la Tabla 5.2(d)) muestra cu´ an bien nuestra metodolog´ıa se comporta en este dominio. En cuanto a los tiempos de ejecuci´ on, para CC-EMO son aproximadamente de una hora y media, mientras que para APRIORI y SUBDUE son s´ olo de unos pocos minutos.

5.5.

Compactaci´ on de la base de datos

Aparte de la informaci´ on sobre los t´erminos de GO para cada instancia de la base de datos, contamos con informaci´ on sobre la expresi´ on de cada uno de estos genes. Como ya hemos mencionado en la Secci´ on 5.1, hemos agrupado esta informaci´ on en 24 clusters mediante el algoritmo k-medias. Por lo tanto, tenemos los mismos genes agrupados de dos maneras diferentes utilizando informaci´ on independiente una de la otra. Teniendo esta informaci´ on de control, podremos realizar una depuraci´ on de los clusters obtenidos por CC-EMO conservando solamente aquellos que sean relevantes desde el punto de vista de los perfiles de expresi´ on gen´etica provistos por la informaci´ on de control. Este proceso se realizar´ a calculando la intersecci´ on de todos los clusters obtenidos por CC-EMO, a los cuales llamaremos ClustersB, contra aquellos del conjunto de control, llamados ClustersA. En las Figuras 5.11(a) y 5.11(b) se ilustran las intersecciones de APRIORI y SUBDUE con respecto a los perfiles de expresi´ on. Adem´ as, la Figura 5.11(c) muestra las intersecciones con respecto a CC-EMO. Los gr´ aficos representan cada intersecci´ on con un c´ırculo, cuyo tama˜ no crece a medida que aumenta el n´ umero de elementos en la intersecci´ on entre los clusters, mientras que el color muestra el p-value para la intersecci´ on (ver Secci´ on 3.6). Los valores de p-value mayores de 3,10−4 no se representan, ya que no ser´ıan suficientemente significativos. APRIORI y SUBDUE encuentran un menor n´ umero de clusters relevantes comparados con CC-EMO. Es m´ as, todos ellos est´ an incluidos en el conjunto de clusters obtenidos por nuestra metodolog´ıa. Notar que casi todas las intersecciones involucran a los clusters 15, 20 y 21 de ClustersA. Este conjunto de clusters contiene muchos conjuntos en ClustersB que los intersecan. Sin embargo, las descripciones asociadas a ellos no son muy espec´ıficas, con solamente uno o dos t´erminos de GO en el segundo o tercer nivel de la jerarqu´ıa. A pesar de ello, son descripciones v´ alidas que cubren un amplio conjunto de genes diferentes. Estudiaremos ahora un par de ejemplos de estas intersecciones encontradas por CC-EMO para comprender mejor los resultados obtenidos. Comenzaremos estudiando el cluster 13 de ClustersA. En la Tabla 5.3(a) se recogen todos los clusters de ClustersB obtenidos por CC-EMO que intersecan al cluster 13 de ClusterA con un p-value menor que 3,10−4 . En la Tabla 5.4 se muestran las

146

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

APRIORI

SUBDUE

CC-EMO

(a) Boxplots de la m´ etrica C

APRIORI

SUBDUE

CC-EMO

(b) Boxplots de la m´ etrica N D

Figura 5.10: Boxplots de las m´etricas C y N D para CC-EMO en el dominio de ontolog´ıa de genes.

´ DE LA BASE DE DATOS 5.5. COMPACTACION

8

3

···

57

15

147

8 15

20

0

22 2

5

···

3e-04

3

20 22 11 10 13 14 17 3

(a) APRIORI

(b) SUBDUE

1 6 7 8 10 12 13 14 16 16 58 736 673 805 510 454 89 179 256 380 536 607 759 451 864 905 74 433 684

15 17 20 21 22 24 804 811 821 816 366 167 913 831 337 207 340 363 500 824 803 604 809 891 267 299 (c) CC-EMO

Figura 5.11: Intersecci´ on de los ClustersA y ClustersB para APRIORI, SUBDUE y CC-EMO. No se muestran todas las intersecciones de CC-EMO en esta gr´ afica, el gr´ afico completo se encuentra en el Ap´endice A.1.

148

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

descripciones de GO para cada una de estas intersecciones. De las descripciones de los clusters de ClustersB que intersecan con el cluster 13 de ClustersA, obtenidas de la Tabla 5.4 y la Figura 5.12, se puede inferir que los genes cubiertos tienen una o varias de las siguientes propiedades: ClusterB 179 536 759 256 89 380 607

Tama˜ no 7 69 42 21 104 18 179

Intersecci´ on 5 12 10 6 14 6 18

p-value 2,2010−6 1,5210−5 1,4310−6 1,9110−4 5,7910−5 5,4310−5 2,3710−4

ClusterA #13 - Tama˜ no: 74 (a) Cluster 13 de ClusterA

ClusterB 363 500 824 340

Tama˜ no 88 71 36 5

Intersecci´ on 7 7 7 3

p-value 2,7110−5 6,3510−6 5,0210−8 1,2110−5

ClusterA #17 - Tama˜ no: 20 (b) Cluster 17 de ClusterA

Tabla 5.3: Ejemplos de intersecci´ on de clusters Integran la membrana plasm´ atica o, en un caso m´ as general, la membrana, es decir, penetrando por lo menos en una bicapa fosforol´ıpida de una membrana o de la membrana del plasm´ atica. Tambi´en se refiere al estado de ser enterrado en la bicapa sin exposici´ on fuera de la misma. Trabajan en el proceso fisiol´ ogico celular o, en un caso m´ as espec´ıfico, en apoptosis4 . Corresponde a los procesos pertinentes a la funci´ on integrada de una c´elula y, en el caso espec´ıfico de apoptosis, a una forma de muerte programada de la c´elula inducida por las se˜ nales externas o internas que 4 La

muerte celular programada o apoptosis es el conjunto de reacciones bioqu´ımicas que ocurren en las c´ elulas cuando se diferencian y ejercen funciones normales, concluyendo tras un cierto n´ umero de divisiones celulares con la muerte celular de una forma ordenada y silenciosa. Por esta raz´ on se conoce a la apoptosis como muerte celular programada.

´ DE LA BASE DE DATOS 5.5. COMPACTACION Proceso biol´ ogico GO:0006915 apoptosis (level: 6) GO:0007165 signal transduction (level: 4) GO:0007165 signal transduction (level: 4) GO:0007154 cell communication (level: 3) GO:0007154 cell communication (level: 3) GO:0050875 cellular physiological process (level: 3) GO:0007165 signal transduction (level: 4) GO:0050875 cellular physiological process (level: 3)

#ClusterB 179 536 759 89 256

380

607

Funci´ on molecular

149 Componente celular GO:0005887 integral to plasma membrane (level: 4) GO:0016021 integral to membrane (level: 3) GO:0005887 integral to plasma membrane (level: 4) GO:0016021 integral to membrane (level: 3) GO:0016021 integral to membrane (level: 3)

GO:0016021 integral to membrane (level: 3)

GO:0004871 signal transducer activity (level: 2)

GO:0016021 integral to membrane (level: 3)

Tabla 5.4: Clusters derivados de la informaci´ on de GO por CC-EMO (ClustersB) que intersecan de manera significativa con el cluster 13 obtenido con la informaci´ on de expresi´ on (ClustersA).

GO:0003673

GO:0003673

···

···

···

GO:0050875

GO:0007154

GO:0016021

···

GO:0007165

···

GO:0006915 (a) Proceso biol´ ogico

GO:0005887 (b) Componente celular

Figura 5.12: Secci´ on de las jerarqu´ıas de GO.

150

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION accionan la actividad de ciertas enzimas, cuyas acciones desmontan la c´elula y tienen como resultado la muerte de la misma. Pertenecen a un proceso de la comunicaci´ on de la c´elula, que puede ser cualquier proceso que medie interacciones entre una c´elula y sus alrededores. Abarcan interacciones tales como se˜ nalizaci´ on o enlace entre una c´elula y otra, entre una c´elula y una matriz extracelular, o entre una c´elula y cualquier otro aspecto de su entorno. Tambi´en pueden se˜ nalar, de manera m´ as espec´ıfica, el proceso de transducci´ on, el cual produce una cascada de los procesos por los cuales una se˜ nal obra rec´ıprocamente con un receptor causando un cambio en el nivel o en la actividad de un segundo mensajero u otro blanco en sentido descendiente, y en u ´ltima instancia, efectuar un cambio en el funcionamiento de la c´elula. Tienen una actividad de transducci´ on de una se˜ nal, lo que significa que media la transferencia de una se˜ nal del exterior al interior de una c´elula por otros medios que la introducci´ on de la mol´ecula de la se˜ nal en s´ı misma en la c´elula.

En la Figura 5.13 se muestran los gr´ aficos de niveles de expresi´ on correspondientes a los genes que intersecan al cluster 13 de ClustersA. Cada subgr´ afico del a´rbol corresponde al conjunto de genes que se encuentran modelados por el ClusterB que se indica en la esquina superior derecha de cada gr´ afico. La jerarqu´ıa entre gr´ aficos viene dada por su inclusi´ on teniendo en cuenta las descripciones de GO asociadas a cada subestructura. Tambi´en se puede ver que el cluster 380 de ClustersB es hijo del cluster 256 de ClustersB. Esto es debido a que, como puede observarse en la Tabla 5.4, la descripci´ on para el cluster 380 es igual a la del cluster 256 salvo por un c´ odigo de GO que, como puede verse en la Figura 5.12, es descendiente de aquel con el cual difiere del grupo 256. Por lo tanto, se puede concluir que el cluster 380 es descendiente del cluster 256. Siguiendo el proceso de compactaci´ on explicado en la Secci´ on 3.6, podemos eliminar el cluster 256 de ClustersB y quedarnos solamente con el cluster 380 de ClustersB, debido a que el primero es dominado por el segundo teniendo en cuenta los genes que componen el cluster 13 de ClustersA. Por otro lado, seleccionamos un cluster de cada rama, escogiendo el cluster 89 de ClustersB en la tercera, el cual es el cluster con una descripci´ on m´ as general. Ahora estudiaremos el cluster 17 de ClustersA. En la Tabla 5.3(b) se muestran todos los clusters de ClustersB que intersecan con el cluster 17 de ClustersA con un p-value menor a 3,10−4 , mientras que en la Tabla 5.5 se muestran las descripciones para cada una de las intersecciones. De las descripciones de los clusters de ClustersB que intersecan con el cluster 17 de ClustersA, obtenidas de la Tabla 5.5 y la Figura 5.14, se puede inferir que los genes cubiertos tienen una o varias de las siguientes propiedades:

´ DE LA BASE DE DATOS 5.5. COMPACTACION

25000 0

5000

10000

15000

20000

25000 15000

20000

#607

5000

10000

15000

20000

#536

#759

0

5000

10000

15000

20000

25000

#380

25000

0

5000

10000

15000 10000 5000 0 25000 20000 15000 10000 5000

#89

0

25000

#256

20000

#179

0

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

25000

151

Figura 5.13: Expresi´ on del cluster 13 de ClustersA y su relaci´ on con los ClustersB con los cuales interseca. Los ClustersB representados corresponden a la intersecci´ on entre ´estos y el cluster 13 de ClustersA. La jerarqu´ıa viene dada por la relaci´ on entre los t´erminos de GO de cada cluster conceptual. Los gr´ aficos remarcados corresponden a aquellos clusters que contienen los mismos genes.

Pertenecen a la regi´ on extracelular o al espacio extracelular. En el primer caso, esto significa que pertenecen al espacio externo a la estructura exterior de una c´elula. Para las c´elulas sin estructuras externas de encapsulado o protectoras, esto se refiere al espacio fuera de la membrana plasm´ atica. Para el segundo caso, esto significa que pertenecen a la parte de un organismo multicelular fuera de la c´elula, tomadas generalmente para estar

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

152

#ClusterB 500

Proceso biol´ ogico

Funci´ on molecular GO:0005102 receptor binding (level: 3)

363

GO:0005576 extracellular region (level: 2) GO:0005615 extracellular space (level: 3) GO:0005621 intracellular (level: 3)

824 340

Componente celular

GO:0006954 inflammatory response (level: 5)

Tabla 5.5: Clusters derivados de la informaci´ on de GO por CC-EMO (ClustersB) que intersecan de manera significativa con el cluster 17 obtenido con la informaci´ on de expresi´ on (ClustersA).

GO:0003673 ···

···

GO:0005576

GO:0005621

GO:0005615 (a) Componente celullar

Figura 5.14: Secci´ on de la jerarqu´ıa de GO

fuera de las membranas plasm´ aticas, y ocupadas por l´ıquido. Son intracelulares, lo que significa que pertenecen al contenido vivo de una c´elula. M´ as detalladamente, la materia contenida dentro (pero no incluyendo) a la membrana plasm´ atica, tomada generalmente para excluir las vacuolas y las masas grandes del material secretor o ingerido. En eucariotas, incluye el n´ ucleo y el citoplasma. Adem´ as, tienen un proceso biol´ ogico de la respuesta inflamatoria, es decir, la reacci´ on defensiva inmediata (por el tejido vertebrado) a la infecci´ on o lesi´ on causada por los agentes qu´ımicos o f´ısicos. El proceso se caracteriza por la vasodilataci´ on local, la extravasaci´ on del plasma en espacios intercelulares y la acumulaci´ on de las c´elulas de sangre y de los macr´ ofagos blancos. Recordemos de la descripci´ on del experimento biol´ ogico sobre el cual estamos trabajando, que ´este estudia la respuesta inflamatoria a una endotoxina. Por lo

´ 5.6. PREDICCION

153

tanto, el conjunto de clusters de ClustersB extra´ıdos por CC-EMO asociados al cluster 17 de ClustersA podr´ıa llegar a ser relevante para aquellos bi´ ologos que han dise˜ nando y desarrollado el experimento. Estamos, de hecho, mostrando que existe una relaci´ on entre la expresi´ on de un grupo de genes y sus propiedades (procesos biol´ ogicos, funci´ on molecular y componente celular). En la Figura 5.15 se muestran los gr´ aficos de niveles de expresi´ on correspondientes a los genes que intersecan al cluster 17 de ClustersA. Cada subgr´ afico del a´rbol corresponde al conjunto de genes que se encuentran modelados por el ClusterB que se indica en la esquina superior derecha de cada gr´ afico. La jerarqu´ıa entre gr´ aficos viene dada por su inclusi´ on teniendo en cuenta las descripciones de GO asociadas a cada subestructura. Por lo tanto, considerando esta nueva informaci´ on externa de control, podemos reducir el conjunto de subestructuras extra´ıdas por CC-EMO eliminando aquellos clusters que se encuentran dominados dentro de la intersecci´ on. Nuevamente, no es posible realizar esto sin informaci´ on externa de control ya que los tres grupos no son dominados, con lo cual se deduce que involucran a un conjunto de elementos cuya intersecci´ on no es significativa con respecto al total de genes.

5.6.

Predicci´ on

Las subestructuras obtenidas por CC-EMO, y posteriormente depuradas durante la compactaci´ on mediante el uso de una base de datos con informaci´ on externa, no s´ olo nos proveen de buenas descripciones de clusters comprensibles por el ser humano, sino que tambi´en proporcionan nuevas anotaciones para la base de datos original. Es decir, mientras que las anotaciones de esta base de datos original se basan en procesos biol´ ogicos, funciones moleculares y componentes celulares realizadas de manera independiente, nuestra propuesta logra definir nuevas anotaciones que utilizan todos estos datos en forma conjunta. Para ilustrar este hecho, en la Figura 5.16 se muestra un ejemplo de una nueva anotaci´ on basada en el cluster 380 de ClustersB. Como se puede ver gr´ aficamente, en este caso la nueva anotaci´ on utiliza el conocimiento de la jerarqu´ıa de GO correspondiente a proceso biol´ ogico y a componente celular, generando una anotaci´ on compuesta, la cual permite definir de manera m´ as espec´ıfica y, por lo tanto, m´ as informativa, a un conjunto de genes. Una vez concluido el proceso de clustering y la compactaci´ on de los clusters generados, pueden clasificarse nuevas instancias en los diferentes conjuntos obtenidos. Dado que los clusters no son disjuntos, puede que una instancia dada pertenezca a uno o m´ as conjuntos. Tal como se explica en la Secci´ on 3.7, nuestra metodolog´ıa utiliza un clasificador difuso basado en el k-prototipo m´ as cercano. El c´ alculo del grado de pertenencia de la observaci´ on x q con el conjunto I de subestructuras previamente identificadas se realiza mediante la ecuaci´ on 3.7.

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

25000 5000

10000

15000

20000

#340

0

0

5000

10000

15000

20000

#363

#824

0

5000

10000

15000

20000

25000

0

5000

10000

15000

20000

#500

25000

25000

0

5000

10000

15000

20000

25000

154

Figura 5.15: Expresi´ on del cluster 17 de ClustersA y su relaci´ on con los ClustersB con los cuales interseca. Los ClustersB representados corresponden a la intersecci´ on entre ´estos y el cluster 17 de ClustersA. La jerarqu´ıa viene dada por la relaci´ on entre los t´erminos de GO de cada cluster conceptual. Los gr´ aficos remarcados corresponden a aquellos clusters que contienen los mismos genes. Nombre 212659_s_at

Proceso biol´ ogico GO:0006954

Funci´ on molecular GO:0005152

Componente celular GO:0005615

Tabla 5.6: Descripci´ on del gen 212659_s_at. Por ejemplo, queremos clasificar el gen 212659_s_at (ver Tabla 5.6). De todos los clusters generados por CC-EMO y depurados en el proceso de validaci´ on, 212659_s_at tiene un grado de pertenencia mayor a cero a los clusters 500, 340 y 824 de ClusterB (ver Figura 5.15). Estos valores son 0,27670, 0,34812 y 0,37518, respectivamente. Por lo tanto, clasificaremos a 212659_s_at como perteneciente al cluster 824 de ClustersB: knn(xq = 212659_s_at, V#500 , V#340 , V#824 ) = V#824 /

5.7. COMENTARIOS FINALES

155 GO:0003673

GO:0008150

GO:0003674

···

GO:0009987

···

GO:0007154

···

GO:0050875

GO:0007165

···

···

GO:0006915 ···

GO:0005575 ···

GO:0007154

··· GO:0016021

···

···

···

··· GO:0005887

GO:0015411

···

···

Figura 5.16: Ejemplo de una nueva anotaci´ on para el dominio de ontolog´ıa de genes basado en el cluster 380 de ClustersB. µi,q = max{µ#500,q , µ#340,q , µ#824,q } = = max{0, 27670, 0, 34812, 0, 37518} = 0, 37518 Como puede verse en la Figura 5.17, su expresi´ on es muy similar a aquellas de los genes pertenecientes al mismo conjunto.

5.7.

Comentarios finales

En este cap´ıtulo se ha aplicado la metodolog´ıa propuesta a un problema de regulaci´ on gen´etica en organismos eucariotas, consistente en el estudio de la respuesta gen´etica a procesos inflamatorios en seres humanos [79]. Para la construcci´ on de la base de datos, se ha utilizado un repositorio estructurado llamado Gene Ontology (GO). Este repositorio almacena informaci´ on, en diversas jerarqu´ıas y a diferentes niveles, que provee un buen modelado de los genes estudiados en el experimento. La aplicaci´ on de la metodolog´ıa propuesta a este problema gener´ o resultados superiores a los conseguidos por los otros dos enfoques –APRIORI y SUBDUE– utilizados en la comparativa. El proceso de compactaci´ on basado en informaci´ on externa, en este caso, datos sobre los niveles de expresi´ on de cada gen, provee al usuario de una explicaci´ on de cada conjunto de genes que se expresan en forma similar. Esta explicaci´ on se realiza en base a los t´erminos de GO. Las conceptos aprendidos

···

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION

0

5000

10000

15000

20000

25000

156

Figura 5.17: Expresi´ on del cluster 824 de ClustersB, donde se clasifica el gen 212659_s_at. La instancia clasificada se muestra en color rojo. pueden contener informaci´ on de las diferentes jerarqu´ıas de GO y, por lo tanto, permiten generar nuevas anotaciones de los genes utilizando una conjunci´ on de diversos t´erminos. Por u ´ltimo, es importante destacar la capacidad de la metodolog´ıa para predecir el comportamiento de nuevos genes a partir de los conceptos aprendidos y depurados, como se observa en el ejemplo de predicci´ on de la Secci´ on 5.6.

Comentarios finales

Dedicaremos esta secci´ on a resumir brevemente los resultados obtenidos y a destacar las conclusiones que esta memoria puede aportar. Adem´ as, comentaremos algunos aspectos sobre trabajos futuros que siguen la l´ınea aqu´ı expuesta y sobre otras l´ıneas de investigaci´ on que se pueden derivar.

I.

Resumen y conclusiones

En esta memoria, hemos presentado una metodolog´ıa general que permite la extracci´ on de conocimiento interpretable de una base de datos estructurada. Esto se ha realizado bajo la perspectiva de obtener una metodolog´ıa robusta y, a la vez, flexible y adaptable a diferentes problemas biol´ ogicos, e incluso de otras a´reas. El eje central de la propuesta se basa en el modelado de una base de datos estructurada y en la utilizaci´ on de la optimizaci´ on multiobjetivo para conseguir distintas soluciones que permitan al usuario seleccionar aquellas de su preferencia y retroalimentar a la metodolog´ıa haciendo uso de esta informaci´ on. En concreto, hemos considerado el uso de los algoritmos evolutivos multiobjetivo como t´ecnica para la extracci´ on de las subestructuras de la base de datos. Los siguientes apartados resumen brevemente los resultados obtenidos y presentan algunas conclusiones sobre los mismos. Aquellos resultados que ya han sido publicados van acompa˜ nados de las referencias bibliogr´ aficas correspondientes.

I.1.

Metodolog´ıa

A continuaci´ on se resumir´ an las caracter´ısticas que distinguen a la metodolog´ıa CC-EMO de otros m´etodos de miner´ıa de datos: CC-EMO considera varios criterios de clustering simult´ aneamente, a diferencia de una agregaci´ on en un u ´nico criterio de optimizaci´ on. De esta 157

158

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION manera, es capaz de encontrar las soluciones o´ptimas en m´ ultiples criterios (optimalidad de Pareto [33]), lo cual evita los sesgos que pueden resultar de utilizar un esquema espec´ıfico de pesos [80]. Esto permite detectar clusters cohesivos con un soporte reducido que agrupan un n´ umero peque˜ no de genes, que no pueden detectarse por m´etodos que optimizan u ´nicamente el n´ umero de instancias en una subestructura [2]. CC-EMO permite la pertenencia de una instancia a m´ as de una subestructura utilizando un clasificador flexible [18, 26, 40]. Por lo tanto, trata expl´ıcitamente a las subestructuras como hip´ otesis, que pueden ser luego validadas y refinadas [66]. Esto distingue a CC-EMO de otros enfoques de clustering que prematuramente fuerzan a las instancias a pertenecer a clusters disjuntos. CC-EMO realiza una selecci´ on de caracter´ısticas local para cada subestructura, dado que no todas las caracter´ısticas son relevantes para todos los grupos [58], y a priori no se conoce qu´e caracter´ıstica ser´ a relevante para un conjunto dado de instancias. Por tanto, es una filosof´ıa muy diferente a los enfoques que filtran o reducen caracter´ısticas para todos los posibles clusters [91]. Esto se ha logrado mediante el uso de la programaci´ on gen´etica [59], la cual permite construir conceptos incrementalmente, incorporando s´ olo aquellas caracter´ısticas que sean relevantes para el cluster que cada concepto define. CC-EMO tiene una naturaleza multimodal que permite la descripci´ on alternativa de un sistema brindando de varias soluciones adecuadas [33, 82], recuperando soluciones localmente o´ptimas, lo cual puede llegar a ser relevante al usuario. Esto diferencia a CC-EMO de otros m´etodos que est´ an focalizados en un u ´nico o´ptimo. CC-EMO difiere de los m´etodos de aprendizaje supervisado, que agrupan las caracter´ısticas e instancias en base a la definici´ on expl´ıcita de variables dependientes. CC-EMO considera los datos externos como una caracter´ıstica independiente y, por ello, permite la clasificaci´ on de instancias en su ausencia. En otras palabras, no realiza un agrupamiento basado en una clase dada por un experto. M´ as a´ un, CC-EMO minimiza el n´ umero de subestructuras utilizando una estrategia de compactaci´ on flexible que agrupa subestructuras similares basada en la capacidad de describir las instancias utilizando caracter´ısticas independientes a las aplicadas en el proceso de aprendizaje de las subestructuras, en contraposici´ on a otros enfoques que utilizan una compactaci´ on de base de datos irreversible [54].

I. RESUMEN Y CONCLUSIONES

I.2.

159

Dise˜ no de modelos de objetos biol´ ogicos

Para poder aplicar nuestra metodolog´ıa a distintos problemas en el a´rea de la bioinform´ atica, es necesario dise˜ nar bases de datos estructuradas de instancias biol´ ogicas. Para ello, se requiere la extracci´ on de caracter´ısticas de estos objetos a trav´es de modelos de los mismos. A continuaci´ on, se resumir´ an las t´ecnicas utilizadas para obtener los distintos modelos generados: Se han modelado diferentes caracter´ısticas de las regiones reguladoras de un gen mediante t´ecnicas de clustering y modelado difuso [99]. Para ello, se han utilizado caracter´ısticas propias de la regulaci´ on transcripcional, incluyendo caracter´ısticas cis (por ejemplo, factores de transcripci´ on, distancias entre ellos, etc.) y perfiles de expresi´ on. El procedimiento general para el modelado de estos objetos biol´ ogicos consta de tres fases: • Modelar las instancias mediante un conjunto de atributos, siguiendo varios pasos, entre los cuales se incluyen: (1) analizar los niveles de expresi´ on de los genes, obtenidos a trav´es de experimentos de microarray. Esto se lleva a cabo identificando las caracter´ısticas cis de las secuencias de ADN, a partir de las bases de datos disponibles; y (2) realizar un modelado inicial de cada caracter´ıstica, para luego examinar las regiones promotoras del genoma detectando estos atributos, aceptando m´ ultiples ocurrencias de una misma caracter´ıstica. • Realizar un clustering de los resultados en subgrupos, modelando las caracter´ısticas, y generando atributos compuestos por medio de la descomposici´ on o combinaci´ on de diferentes caracter´ısticas individuales. De esta forma se logra aumentar la confianza en ellas, en base a una mayor cantidad de atributos compartidos. • Describir las regiones promotoras utilizando los modelos resultantes. En particular, se ha aplicado un modelado difuso para la b´ usqueda y reconocimiento del sitio de binding de la ARN polimerasa (la enzima que permite la transcripci´ on de un gen), conocido con el nombre de promotor [5]. Para ello, se ha utilizado diferentes t´ecnicas para llevar a cabo la b´ usqueda, algoritmos gen´eticos [77, 95] y un sistema h´ıbrido redes neuronalesalgoritmos gen´eticos [29]. Esto se ha conseguido al utilizar sistemas gen´eticos difusos para solucionar el problema del reconocimiento de promotores, un problema de optimizaci´ on multimodal y multiobjetivo. El m´etodo de reconocimiento propuesto, validado mediante la predicci´ on de promotores del organismo E. coli, combina las ventajas de la representaci´ on de caracter´ısticas basadas en conjuntos difusos y las capacidades de b´ usqueda de los algoritmos evolutivos multiobjetivo para obtener soluciones precisas y a la vez interpretables [77, 78]. En particular, esta clase de soluciones ayuda a descubrir posibles

160

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION sitios de transcripci´ on (sitios putativos) mediante la detecci´ on de m´ ultiples instancias de promotores en una misma secuencia. Esto provee una descripci´ on completa de diversas posibilidades de regulaci´ on que pueden ocurrir en las regiones interg´enicas de un genoma, permitiendo la predicci´ on de distintas actividades reguladoras, tanto de activaci´ on como de represi´ on. El proceso de reconocimiento y los modelos difusos obtenidos se han optimizado mediante un algoritmo de ajuste basado en algoritmos gen´eticos en [95], extendido posteriormente utilizando un algoritmo de ajuste multiobjetivo tambi´en basado en algoritmos gen´eticos. El ajuste multiobjetivo, a diferencia del monobjetivo, produjo un conjunto resultados posibles al problema planteado, en lugar de una u ´nica soluci´ on. De esta manera, se provee al usuario de diferentes opciones y ´este selecciona aquella que m´ as se ajusta a sus necesidades. Para nuestra aplicaci´ on se opt´ o por una soluci´ on global que mejor generalizaba la base de datos.

I.3.

Aplicaci´ on a organismos procariotas

Hemos aplicado nuestra metodolog´ıa al problema de regulaci´ on gen´etica en organismos procariotas. En la primera etapa de la metodolog´ıa, se ha modelado la informaci´ on obtenida de la base de datos en bruto utilizando t´ecnicas basadas en l´ ogica difusa, aprendizaje autom´ atico y algoritmos gen´eticos multiobjetivo. Gracias a este proceso, se han podido detectar, en los genomas de E. coli y Salmonella, secuencias con caracter´ısticas similares a las de los modelos obtenidos, que no hab´ıan sido detectadas anteriormente. Estas nuevas instancias de los modelos se han verificado biol´ ogicamente mediante diversas t´ecnicas de biolog´ıa molecular (por ejemplo, footprinting in vivo) [100]. De esta manera, se ha logrado ampliar la base de datos existente, mejorando, a su vez, el proceso de clustering posterior. Al finalizar la aplicaci´ on de las distintas etapas de la metodolog´ıa, se logr´ o obtener como resultado un conjunto de clusters que representaban conceptos diversos y agrupaban a los distintos genes de la base de datos en base a la combinaci´ on de las diferentes caracter´ısticas modeladas. Gracias a trabajos realizados por otros autores sobre estos genes [100, 89], pudimos comprobar que los conceptos inferidos por nuestra metodolog´ıa son correctos y cohesivos, ayudando a describir grupos de genes que se expresan en forma similar en base a propiedades obtenidas de sus regiones reguladoras. De esta manera, se provee al usuario de una herramienta de caja blanca robusta y, a la vez, flexible a sus necesidades.

´ FUTURAS II. L´INEAS DE INVESTIGACION

I.4.

161

Aplicaci´ on a organismos eucariotas

Hemos utilizado nuestra metodolog´ıa en el estudio de la respuesta gen´etica a procesos inflamatorios en seres humanos. Para ello, modelamos las instancias de la base de datos utilizando la informaci´ on provista por la base de datos “Gene Ontology” [8]. Esta base de datos estructurada provee informaci´ on sobre las distintas propiedades de las secuencias biol´ ogicas, en base a diferentes niveles de especificidad. La aplicaci´ on de la metodolog´ıa CC-EMO logra identificar clusters conceptuales y clasificar un grupo de genes co-regulados en base a m´ ultiples caracter´ısticas, incluyendo descripciones funcionales, procesos moleculares y componentes celulares. CC-EMO genera subestructuras que agrupan genes que comparten conjuntos de caracter´ısticas [76]. Las subestructuras generadas son tratadas como hip´ otesis, que luego se emplean para conducir b´ usquedas en genomas completos. Esto produce anotaciones en diferentes tipos de caracter´ısticas en m´ ultiples niveles de especificidad, para capturar miembros adicionales de una subestructura, consiguiendo as´ı caracterizaciones de perfiles de genes m´ as apropiadas. CC-EMO utiliza un entorno multivariable y multinivel, donde las subestructuras se descubren en base a diversos tipos de caracter´ısticas jer´ arquicas. Por ejemplo, las subestructuras extra´ıdas de la base de datos de “Gene Ontology” incluyen caracter´ısticas o t´erminos derivados de diferentes tipos de informaci´ on. M´ as a´ un, cada caracter´ıstica est´ a definida a distintos niveles de especificidad en un estructura basada en grafos. Esto distingue nuestra metodolog´ıa de los enfoques previos, donde las caracter´ısticas se tratan individualmente en un tipo de informaci´ on particular, y el nivel de especificidad se selecciona a priori [4].

II.

L´ıneas de investigaci´ on futuras

A continuaci´ on, consideraremos algunas extensiones posibles sobre la metodolog´ıa propuesta en esta memoria y discutiremos varias l´ıneas de investigaci´ on inmediatas. Con respecto al modelado de objetos biol´ ogicos correspondiente a las caracter´ısticas de la regi´ on reguladora de organismos procariotas, se plantean varias l´ıneas futuras posibles: Ser´ıa interesante realizar un an´ alisis exhaustivo de diferentes m´etodos – redes neuronales, modelos ocultos de Markov, redes bayesianas, etc.– que permita mejorar el modelado de los distintos objetos biol´ ogicos y, por lo tanto, su posterior reconocimiento. Mediante este an´ alisis se podr´ıa llegar a realizar la b´ usqueda de los diferentes objetos biol´ ogicos, cada uno utilizando el m´etodo de reconocimiento que mejor se adapte a sus necesidades. El desarrollo de una metodolog´ıa que permita el reconocimiento de diferentes clases de factores σ y su relaci´ on con el resto de los componentes de la

162

´ A ORGANISMOS EUCARIOTAS CAP´ITULO 5. APLICACION regi´ on reguladora de un gen tambi´en ser´ıa una l´ınea de acci´ on interesante.

En relaci´ on con el modelado de objetos biol´ ogicos correspondiente a las caracter´ısticas, en t´erminos de la base de datos “Gene Ontology”, que presentan las secuencias biol´ ogicas eucariotas, se propone una extensi´ on del modelado presentado en esta memoria que permita un emparejamiento difuso de las subestructuras y las instancias cubiertas por las mismas. Utilizando un modelado difuso se puede llegar mejorar la representaci´ on, con la consecuente ventaja en la aplicaci´ on al dominio eucariota que beneficiar´ıa a sus usuarios. Con respecto a la etapa central de la metodolog´ıa propuesta, el clustering conceptual multiobjetivo, se propone la posibilidad de incorporar la capacidad de descubrir diferentes explicaciones de un mismo cluster, a´ un cuando una de ellas supere a las otras en todos los objetivos a optimizar. Para ello, se necesita incorporar a CC-EMO la capacidad de crear nichos en el espacio genot´ıpico. Esto implica comparar no s´ olo si dos subestructuras representan a las mismas instancias de la base de datos, sino tambi´en si genot´ıpicamente son similares, es decir, si est´ an compuestas por un mismo subconjunto de caracter´ısticas. Esto brindar´ıa al usuario m´ as de una descripci´ on posible para un mismo cluster, lo que permitir´ıa un mejor sistema de retroalimentaci´ on, evitando proveer de soluciones que no sean las requeridas por el usuario. En referencia a las posibles aplicaciones de la metodolog´ıa a otros dominios, existen diversos problemas biol´ ogicos que guardan informaci´ on en bases de datos estructuradas con los que podr´ıamos trabajar directamente. Un ejemplo es la base de datos BIND (Biomolecular Interaction Network Database) [6], que acumula informaci´ on sobre interacciones prote´ına-prote´ına. Esta base de datos es una colecci´ on de informaci´ on sobre interacciones moleculares, cuyos contenidos incluyen informaci´ on recuperada de la literatura cient´ıfica y de datos obtenidos mediante experimentos biol´ ogicos de gran escala. En el repositorio BIND se acumulan asociaciones moleculares con tres clasificaciones: mol´eculas que se asocian unas con otras para formar interacciones, complejos moleculares que est´ an conformadas por una o m´ as interacciones y caminos que est´ an definidas por una secuencia espec´ıfica de una o m´ as interacciones. La aplicaci´ on de nuestra propuesta es sencilla de realizar, solamente se necesitar´ıa un correcto modelado de la base de datos en bruto y, posiblemente, peque˜ nos cambios en las funciones objetivo del algoritmo evolutivo utilizado en la etapa de clustering conceptual. A corto plazo, se pretende aplicar la metodolog´ıa propuesta a otras bases de datos, en particular, Ingenuity [51] y ResNet y ResArt de Pathway Assist [70]. Finalmente, se˜ nalaremos que la metodolog´ıa propuesta no es de uso exclusivo para dominios biol´ ogicos y puede ser utilizada en una gran variedad de dominios con informaci´ on estructurada, tal como se mostr´ o para el dominio geom´etrico.

´ Apendice

A

Tablas y figuras adicionales En este ap´endice se recogen los resultados publicados por Harley & Reynolds [48], indicando la ubicaci´ on de los promotores, originales y alternativos, de cada secuencia, y los resultados completos para CC-EMO aplicado al problema de organismos eucariotas. secuencia TTGACA TATAAT Promotor trpS 15 38 CGGCGAGGCTATCG ATCTCA GCCAGCCT GATGTAATT TATCAG TCTATAAATGACC 12 33 CGGCGAGGCTA TCGATC TCAGCCA GCCTGATG TAATTT ATCAGTCTATAAATGACC trpS 15 39 CAGCTTACTATTGC TTTACG AAAGCGTAT CCGGTGAAA TAAAGT CAACTAGTTGGTTAA trxA 15 38 ATGCAATTTTTTAG TTGCAT GAACTCGC ATGTCTCCA TAGAAT GCGCGCTACTTGATGCC tufB 15 37 TCTCAACGTAACAC TTTACA GCGGCGCG TCATTTGA TATGAT GCGCCCCGCTTCCCGAT tyrT 15 39 ACAGCGCGTCTTTG TTTACG GTAATCGAA CGATTATTC TTTAAT CGCCAGCAAAAATAA tyrT/109 tyrT/140 15 39 TTAAGTCGTCACTA TACAAA GTACTGGCA CAGCGGGTC TTTGTT TACGGTAATCG 13 39 TTAAGTCGTCAC TATACA AAGTACTGGC ACAGCGGGTC TTTGTT TACGGTAATCG tyrT/140 13 34 TGCGCGCAGGTC GTGACG TCGAGAA AAACGTCT TAAGTC GTGCACTATACA tyrT/178 13 33 TGCGCGCAGGTC GTGACG TCGAGAA AAACGTC TTAAGT CGTGCACTATACA tyrT/178 2 24 C ATGTCG ATCATACC TACACAGC TGAAGA TATGATGCGCGCAGGTCGTGACG tyrT/212 13 35 ATTTTTCTCAAC GTAACA CTTTACAG GCGCGTCA TTTGAT ATGATGCGCCCCGCTTC tyrT/6 tyrT/6 20 40 ATTTTTCTCAACGTAACAC TTTACA GGCGCGT CATTTGA TATGAT GCGCCCCGCTTC 13 38 ATTATTCTTTAA TCGCCA GCAAAAATA ACTGGTTACC TTTAAT CCGTTACGGATGAAAAT tyrT/77 32 54 ATTATTCTTTAATCGCCAGCAAAAATAACTG GTTACC TTTAATCC GTTACGGAT GAAAAT tyrT/77 15 37 TGGCTACTTATTGT TTGAAA TCACGGGG GCGCACCG TATAAT TTGACCGCTTTTTGAT uncI uncI 14 37 TGGCTACTTATTG TTTGAA ATCACGGGG GCGCACCG TATAAT TTGACCGCTTTTTGAT 15 38 TCCAGTATAATTTG TTGGCA TAATTAAG TACGACGAG TAAAAT TACATACCTGCCCGC uvrB-P1 15 39 TCAGAAATATTATG GTGATG AACTGTTTT TTTATCCAG TATAAT TTGTTGGCATAATTAA uvrB-P2 15 38 ACAGTTATCCACTA TTCCTG TGGATAAC CATGTGTAT TAGAGT TAGAAAACACGAGGCA uvrB-P3 15 38 GCCCATTTGCCAGT TTGTCT GAACGTGA ATTGCAGAT TATGCT GATGATCACCAAGG uvrC 15 37 TGGAAATTTCCCGC TTGGCA TCTCTGAC CTCGCTGA TATAAT CAGCAAATCTGTATAT uvrD 434PR 15 38 AAGAAAAACTGTAT TTGACA AACAAGAT ACATTGTAT GAAAAT ACAAGAAAGTTTGTTGA 15 38 ACAATGTATCTTGT TTGTCA AATACAGT TTTTCTTGT GAAGAT TGGGGGTAAATAACAGA 434PRM

Tabla A.1: Descripci´ on de los promotores de la base de datos utilizada en la experimentaci´ on.

163

164

´ APENDICE A. TABLAS Y FIGURAS ADICIONALES

TTGACA TATAAT Promotor secuencia aceEF 13 36 ACGTAGACCTGT CTTATT GAGCTTTC CGGCGAGAG aceEF 9 31 ACGTAGAC CTGTCT TATTGAGC TTTCCGGC 15 38 AAGATTGTTGGTTT TTGCGT GATGGTGA CCGGGCAGC ada 15 39 AAGATTGTTGGTTT TTGCGT GATGGTGA CCGGGCAGCC ada 23 46 AAGATTGTTGGTTTTTGCGTGA TGGTGA CCGGGCAGC CTAAAGGC ada 15 39 AACGCATACGGTAT TTTACC TTCCCAGTC AAGAAAACT alaS 15 37 TGCTATCCTGACAG TTGTCA CGCTGATT GGTGTCGT ampC 7 30 GCTATC TTGACA GTTGTCAC GCTGATTGG ampC/C16 15 37 TTAGCGGATCCTAC CTGACG CTTTTTAT CGCAACTC araBAD araBAD 15 39 TTAGCGGATCCTAC CTGACG CTTTTTAT CGCAACTCTC 15 38 GCAAATAATCAATG TGGACT TTTCTGCC GTGATTATA araC 12 37 CTGTTTCCGAC CTGACA CCTGCGTGA GTTGTTCACG araE 13 35 AGCGGATCCTAC CTGGCG CTTTTTAT CGCAACTC araI(c) araI(c)X(c) 13 37 AGCGGATCCTAC CTGGCG CTTTTTATC GCAACTCTC 15 39 TTTGTTTTTCATTG TTGACA CACCTCTGG TCATGATAG argCBH 15 36 TTTGTTTTTCATTG TTGACA CACCTCTGG TCATGA argCBH 15 36 TTTGTTTTTCATTG TTGACA CACCTCT GGTCATAA argCBH-P1/6argCBH-P1/LL 15 36 TTTGTTTTTCATTG TTGACA CACCTCT GGTCATGA 15 38 TTACGGCTGGTGGG TTTTAT TACGCTCA ACGTTAGTG argE-P1 15 38 CCGCATCATTGCTT TGCGCT GAAACAGT CAAAGCGGT argE-P2 14 38 CCGCATCATTGCT TTGCGC TGAAACAGT CAAAGCGGT argE-P2 15 38 CCGCATCATTGCTT TGCGCT GAAACAGT CAAAGCGGT argE/LL13 15 38 ATTGTGAAATGGGG TTGCAA ATGAATAA TTACACATA argF 7 30 TTAGAC TTGCAA ATGAATAA TCATCCATA argI 12 35 TCGTCGCCGCG TTGCAG GAGCAAGG CTTTGACAA argR argR 11 36 TCGTCGCCGC GTTGCA GGAGCAAGG CTTTGACAAT 15 37 TACGAAAATATGGA TTGAAA ACTTTACT TTATGTGT aroF 15 38 AGTGTAAAACCCCG TTTACA CATTCTGA CGGAAGATA aroG 15 37 GTACTAGAGAACTA GTGCAT TAGCTTAT TTTTTTGT aroH bioA 15 39 GCCTTCTCCAAAAC GTGTTT TTTGTTGTT AATTCGGTG 25 47 GCCTTCTCCAAAACGTGTTTTTTG TTGTTA ATTCGGTG TAGACTTG bioA 15 38 TTGTCATAATCGAC TTGTAA ACCAAATT GAAAAGATT bioB 15 38 TTGTTAATTCGGTG TAGACT TGTAAACC TAAATCTTT bioP98 C62.5-P1 14 37 CACCTGCTCTCGC TTGAAA TTATTCTC CCTTGTCCC 13 34 CACCTGCTCTCG CTTGAA ATTATTCTC CCTTGT C62.5-P1 15 38 ATCCCGCCATTAAG TTGACT TTTAGCGC CCATATCTC carAB-P1 15 39 TAAGCAGATTTGCA TTGATT TACGTCATC ATTGTGAAT carAB-P2 13 36 ACGTTGATCGGC ACGTAA GAGGTTCC AACTTTCAC cat 15 36 ACGTTGATCGGCAC GTAAGA GGTTCCA ACTTTCAC cat 23 46 ACGTTGATCGGCACGTAAGAGG TTCCAA CTTTCACC ATAATGAAA cat 13 37 AAACAGGCGGGG GTCTCA GGCGACTAA CCCGCAAAC cit.util-379 cit.util-379 22 46 AAACAGGCGGGGGTCTCAGGC GACTAA CCCGCAAAC TCTTACCTC 14 38 GACAGGCACAGCA TTGTAC GATCAACTG ATTTGTGCC cit.util-431 15 37 TCATATATTGACAC CTGAAA ACTGGAGG AGTAAGGT CloDFcloacin 8 31 TCATATA TTGACA CCTGAAAA CTGGAGGAG CloDFcloacin 15 39 ACACGCGGTTGCTC TTGAAG TGTGCGCCA AAGTCCGGC CloDFnaI colE1-B 15 36 TTATAAAATCCTCT TTGACT TTTAAAA CAATAAGT 9 31 TTATAAAA TCCTCT TTGACTTT TAAAACAA colE1-B 15 37 TTATAAAATCCTCT TTGACT TTTAAAAC AATAAGTT colE1-C colE1-P1 15 38 GGAAGTCCACAGTC TTGACA GGGAAAAT GCAGCGGCG 15 37 TTTTTAACTTATTG TTTTAA AAGTCAAA GAGGATTT colE1-P2 12 37 TTTTTAACTTA TTGTTT TAAAAGTCAAA GAGGATTT colE1-P2 13 37 GCTACAGAGTTC TTGAAG TAGTGGCCC GACTACGGC colE110.13 15 37 TTTTTAACTTATTG TTTTAA AAGTCAAA GAGGATTT colicinE1 P3 15 38 AAGCGAGACACCAG GAGACA CAAAGCGA AAGCTATGC crp 15 38 GTAGCGCATCTTTC TTTACG GTCAATCA GCAAGGTGT cya 15 39 AAGTGCATCAGCGG TTGACA GAGGCCCTC AATCCAAAC dapD deo-P1 14 39 CAGAAACGTTTTA TTCGAA CATCGATCT CGTCTTGTGT 10 35 TGATGTGTA TCGAAG TGTGTTGCG GAGTAGATGT deo-P2 15 37 ACACCAACTGTCTA TCGCCG TATCAGCG AATAACGG deo-P3 15 38 AAACAAATTAGGGG TTTACA CGCCGCAT CGGGATGTT divE 15 39 TGCGGCGTAAATCG TGCCCG CCTCGCGGC AGGATCGTT dnaA-1p dnaA-1p 14 39 TGCGGCGTAAATC GTGCCC GCCTCGCGGC AGGATCGTT 15 38 TCTGTGAGAAACAG AAGATC TCTTGCGC AGTTTAGGC dnaA-2p 15 39 TTTGCATCTCCCCC TTGATG ACGTGGTTT ACGACCCCA dnaK-P1 14 34 TTTGCATCTCCCC CTTGAT GACGTGG TTTACGA dnaK-P1 dnaK-P2 15 37 ATGAAATTGGGCAG TTGAAA CCAGACGT TTCGCCCC 14 33 ATGAAATTGGGCA GTTGAA ACCAGA CGTTTCG dnaK-P2 15 37 GCCAGCGCTAAAGG TTTTCT CGCGTCCG CGATAGCG dnaQ-P1 15 38 GAACCACCAACCTG TTGAGC CTTTTTGT GGAGTGGGT Fpla-oriTpX 15 38 ATTAGGGGTGCTGC TAGCGG CGCGGTGT GTTTTTTTA Fplas-traM 12 38 ATTAGGGGTGC TGCTAG CGGCGCGGTGT GTTTTTTTA Fplas-traM 14 37 GCGTTAATAAGGT GTTAAT AAAATATA GACTTTCCG Fplas-traY/Z Fplas-traY/Z 15 37 GCGTTAATAAGGTG TTAATA AAATATA GACTTTCCG 3 26 GC GTTAAT AAGGTGTT AATAAAATA Fplas-traY/Z 12 34 GATCTCGTCAA ATTTCA GACTTATC GATCAGAC frdABCD 14 36 GATCTCGTCAAAT TTCAGA CTTATCGA TCAGACTA frdABCD 15 38 GTACTAGTCTCAGT TTTTGT TAAAAAAG TGTGTAGGA fumA 17 38 GTACTAGTCTCAGTTT TTGTTA AAAAAGTG TGTAGGA fumA γ-δ-tnpA 15 38 ACACATTAACAGCA CTGTTT TTATGTGT GCGATAATT 14 36 ATTCATTAACAAT TTTGCA ACCGTCCG AAATATTA γ-δ-tnpR 15 36 ATTCATTAACAATT TTGCAA CCGTCCG AAATATTA γ-δ-tnpR

TTCAAT GAGAGT CTAAAG TAAAGG TATCCT TATCTT TACAAT TATCGT TCTACT TACTGT GACACT TATTTT TCTACT TACTAT TATCAA TAGTAT TATTAT TATTAT TATTTT TATGTT TATGTT TATATT TAAAGT TAAATT TATTAA ATTAAT TATCGT TAGATT TATCAT TAGACT TAAACC TAGGTT TAAATT CATCTC CCCCAT CAGAAT TAATAT CATAAT CATAAT TAAGAT TCTTAC TATACA AATAAT AATAAT TAAGGT TACACT TAAAAA TAAGTT AAAAAT TAGCTT TATAAT TATAAT TACACT TATAAT TAAAAC TAAATT GATAAA TAGAAT TAGAAT TATACT TATAGT TACACT TACACT TATGAT TTTAGT CCCCAT TATTAC CCCCTA TAAAAT TAAATT TAGGAT TAGGAT TCTATT TCTATT TAGACT TATACT TACTGT TATTGT TATTGT TATAAT TAAATT TAAATT

GGGACAGGTCCAG TCAATGGGACAGGTCCAG GCTATCCTTAACC CTATCCTTAACC TAACC ATTCCCACTTTTCAGT CTAACGCATCGCCAATG TACAATCTAACGTATCG GTTTCTCCATACCCGTT TTCTCCATACCCGTT TTTGTTACGCGTTTTTG TTCACTATGTCTTACTC GTTTCTCCATACCCGTT TTCTCCATACCCGTTTT TATTCATGCAGTATT CAATATTCATGCAGTATT CAATATTCATGCAGTAT CAATATTCATGCAGTAT TATTCATAAATACTGCA CATATGCGGATGGCG CATATGCGGATGGCG CATATGCGGATGGCG GAATTTTAATTCAATAA GAATTTTAATTCATTGA TCAGTCTAAAGTCTCGG CAGTCTAAAGTCTCGG TACGTCATCCTCGCTG GGAAGTATTGCATTCA GCTAACCACCCGGCGAG TGTAAACCTAAATCT TAAATCT TACAAGTCTACACCGAA TGGTTTACAAGTCGAT TCCCACATCCTGTTTT CTCTCCCACATCCTGTTTT GCCGCCGTTTGCCAGA GCAAATAAAGTGAG GAAATAAGATCACTACC GAAATAAGATCACTACC CACTACC CTCTATACATAATTCTG TAATTCTG TAAATGAAATCAC CATACTGTGTATATAT AATAATCATACTGTGTATATAT GGAAGGACAGATTTGG TAAATACTGTAA AAAAATAAATACTGTAA AAATACTGTACATATAA TTATGCTGTATATAAAA GGAAACCGCGGTAGCGT GGAAACCGCGGTAGCGT AGAAGGACAGTATTTGG GGAAACCGCGGTAGCGT AGTCAGGATGCTACAG GATCACGTTTTAGACC GGGTGATGTGTTTACTG TCTAACATACGGTTGC ACTAACAAACTCGCAA GATCTGATCATTTAAA GCGCGTCATTCCGGAAG TAGCGAGTTCTGGAAA TAGCGAGTTCTGGAAA CCGCGGTCCCGATCG AGTCAACCGCAGTG TTAGTAGTCAACCGCAGTG AGACTCACAACCACA TTACAGACTCACAACCACA AGCGCCGTAACCCC ATTTACGGATAAAG ACCGCTAGGGGCGCTG ACCGCTAGGGGCGCTG TACCTTTTCTGATTATT TACCTTTTCTGATTATT TTCCGTCTATTTACCTTTTCTGATTATT GTTGTACCTATAAAGGA TGTACCTATAAAGGA TACTCGCTTTTAACAGG TACTCGCTTTTAACAGG ATTTCGGACGGTTGCA ATCGCACACATAAAAAC ATCGCACACATAAAAAC

Tabla A.2: Descripci´ on de los promotores de la base de datos utilizada en la experimentaci´ on.

165 TTGACA TATAAT Promotor secuencia gal-P1 15 38 TCCATGTCACACTT TTCGCA TCTTTGTT ATGCTATGG TTATTT gal-P1 6 28 TCCAT GTCACA CTTTTCGC ATCTTTGT TATGCT 15 37 CTAATTTATTCCAT GTCACA CTTTTCGC ATCTTTGT TATGCT gal-P2 13 37 CTAATTTATTCC ATGTCA CACTTTTCG CATCTTTGT TATGCT gal-P2 14 36 TAATTTATTCCAT GTCACA CTTTTCGC ATCTTTGT gal-P2/mut-1 14 41 TAATTTATTCCAT GTCACA CTTTTCGCATCTTTGTTATAC gal-P2/mut-1 14 36 TAATTTATTCCAT GTCACA CTTTTCGC ATTTTTGT gal-P2/mut-2 15 40 CAATTCTCTGATGC TTCGCG CTTTTTATC CGTAAAAAGC glnL 15 38 TAAAAAACTAACAG TTGTCA GCCTGTCC CGCTTATAA gln gltA-P1 15 37 ATTCATTCGGGACA GTTATT AGTGGTAG ACAAGTTT 9 34 ATTCATTC GGGACA GTTATTAGTG GTAGACAAG gltA-P1 15 39 AGTTGTTACAAACA TTACCA GGAAAAGCA TATAATGCG gltA-P2 7 30 AGTTGT TACAAA CATTACCAG GAAAAGCA gltA-P2 glyA 15 38 TCCTTTGTCAAGAC CTGTTA TCGCACAA TGATTCGGT 15 39 ACACCAAAGAACCA TTTACA TTGCAGGGC TATTTTTTA glyA/geneX 15 38 GCATGGATAAGCTA TTTATA CTTTAATA AGTACTTTG gnd 11 34 TTTTTCCCCC TTGAAG GGGCGAAG CCATCCCCA groE groE 10 29 TTTTTCCCC CTTGAA GGGGCG AAGCCAT 11 38 CGGACGAAAA TTCGAA GATGTTTACCGTGGAAAAGGG gyrB 14 38 ATATAAAAAGTTC TTGCTT TCTAACGTG AAAGTGGTT his 15 38 GATCTACAAACTAA TTAATA AATAGTTA ATTAACGCT hisA 15 41 GATCTACAAACTAA TTAATA AATAGTTA ATTAACGCTCAT hisA 23 46 GATCTACAAACTAATTAATAAA TAGTTA ATTAACGC TCATCATTG hisA 15 38 CCTCCAGTGCGGTG TTTAAA TCTTTGTG GGATCAGGG hisBp 15 37 TAGAATGCTTTGCC TTGTCG GCCTGATT AATGGCAC hisJ(St) hisJ(St) 10 34 TAGAATGCT TTGCCT TGTCGGCCT GATTAATGG 15 38 AAATAATAACGTGA TGGGAA GCGCCTCG CTTCCCGTG hisS 15 38 ACATTACGCCACTT ACGCCT GAATAATA AAAGCGTGT htpR-P1 15 39 TTCACAAGCTTGCA TTGAAC TTGTGGATA AAATCACGG htpR-P2 htpR-P2 1 28 TTCACA AGCTTGCATTGAACTTGTGGA 15 38 AGCTTGCATTGAAC TTGTGG ATAAAATC ACGGTCTGA htpR-P3 15 38 GCCAAAAAATATCT TGTACT ATTTACAA AACCTATGG ilvGEDA 14 38 GCCAAAAAATATC TTGTAC TATTTACAA AACCTATGG ilvGEDA ilvGEDA 22 46 GCCAAAAAATATCTTGTACTA TTTACA AAACCTATG GTAACTCTT 14 37 CTCTGGCTGCCAA TTGCTT AAGCAAGA TCGGACGGT ilvIH-P1 15 38 GAGGATTTTATCGT TTCTTT TCACCTTT CCTCCTGTT ilvIH-P2 15 38 GAGGATTTTATCGTTTC TTTTCA CCTTTCCT CCTGTTTAT ilvIH-P2 18 41 ATTTTAGGATTAA TTAAAA AAATAGAG AAATTGCTG ilvIH-P3 15 38 TGTAGAATTTTATT CTGAAT GTCTGGGC TCTCTATTT ilvIH-P4 15 37 CGAGGCCGGTGATG CTGCCA ACTTACTG ATTTAGTG ISlins-PL 13 36 ATATATACCTTA TGGTAA TGACTCCA ACTTATTGA ISlins-PR ISlins-PR 18 41 ATATATACCTTATGGTA ATGACT CCAACTTA TTGATAGTG 7 30 GATGTC TGGAAA TATAGGGG CAAATCCAC IS2I-II 15 38 GACACCATCGAATG GCGCAA AACCTTTC GCGGTATGG lacI 15 39 TAGGCACCCCAGGC TTTACA CTTTATGCT TCCGGCTCG lacP1 14 37 TTTACACTTTATG CTTCCG GCTCGTAT GTTGTGTGG lacP115 lacP115 15 37 TTTACACTTTATGC TTCCGG CTCGTAT GTTGTGTGG 1 25 TTTACA CTTTATGC TTCCGGCTCG lacP115 15 38 AATGTGAGTTAGCT CACTCA TTAGGCAC CCCAGGCTT lacP2 lacP2 13 38 AATGTGAGTTAG CTCACT CATTAGGCA CCCCAGGCTT 22 45 AATGTGAGTTAGCTCACTCAT TAGGCA CCCCAGGC TTTACACTT lacP2 15 38 GGTGTATGCATTTA TTTGCA TACATTCA ATCAATTGT lambdac17 15 38 TAGATAACAATTGA TTGAAT GTATGCAA ATAAATGCA lambdacin 14 37 TGATAAGCAATGC TTTTTT ATAATGCC AACTTAGTA lambdaL57 15 38 CGGTTTTTTCTTGC GTGTAA TTGCGGAG ACTTTGCGA lambdaPI 15 38 TATCTCTGGCGGTG TTGACA TAAATACC ACTGGCGGT lambdaPL 15 38 TACCTCTGCCGAAG TTGAGT ATTTTTGC TGTATTTGT lambdaPo lambdaPR 15 38 TAACACCGTGCGTG TTGACT ATTTTACC TCTGGCGGT 15 38 TTAACGGCATGATA TTGACT TATTGAAT AAAATTGGG lambdaPR’ 15 39 GAGCCTCGTTGCGT TTGTTT GCACGAACC ATATGTAAG lambdaPRE 13 36 GAGCCTCGTTGC GTTTGT TTGCACGAA CCATATGT lambdaPRE 15 38 AACACGCACGGTGT TAGATA TTTATCCC TTGCGGTGA lambdaPRM lep 15 37 TCCTCGCCTCAATG TTGTAG TGTAGAAT GCGGCGTT 2 25 G TTGACA TCCGTTTT TGTATCCAG leu 15 37 TCGATAATTAACTA TTGACG AAAAGCTG AAAACCAC leultRNA 15 38 TGTGCAGTTTATGG TTCCAA AATCGCCT TTTGCTGTA lex livJ 15 38 TGTCAAAATAGCTA TTCCAA TATCATAA AAATCGGGA 7 30 TTGTTG TTTAAA AATTGTTA ACAATTTTG lpd 15 38 CCATCAAAAAAATA TTCTCA ACATAAAA AACTTTGTG lpp 15 39 CCATCAAAAAAATA TTCTCA ACATAAAA AACTTTGTGT lpp 13 37 ATCAAAAAAATA TTCTCA ACATAAAAA ACTTTGTGT lpp/P1 13 37 ATCAAAAAAATA TTCTCA ACATAAAAA ACTTTGTGT lpp/P2 13 36 ATCAAAAAAATA TTCACA ACATAAAA AACTTTGT lpp/R1 lpp/R1 15 37 ATCAAAAAAATA TTCACA ACATAAAA AACTTTGTG 15 38 ATGCGCAACGCGGG GTGACA AGGGCGCG CAAACCCTC Mlrna 14 38 CCCCCGCAGGGAT GAGGAA GGTGGTCGA CCGGGCTCG mac11 14 38 CCCCCGCAGGGAT GAGGAA GGTCGGTCG ACCGGCTCG mac12 14 38 CCCCCGCAGGGAT GAGGAA GGTCGACCT TCCGGCTCG mac21 14 37 CCCCCGCAGGGAT GAGGAA GGTCGGTC GACCGCTCG mac3 mac31 14 37 CCCCCGCAGGGAT GAGGAA GGTCGGTC GACCGCTCG 15 37 AGGGGCAAGGAGGA TGGAAA GAGGTTGC CGTATAAA malEFG 15 37 CAGGGGGTGGAGGA TTTAAG CCATCTCC TGATGACG malK

CATACCATAAG ATGGTTATTTCATACCATAAG ATGGTTATTTCATACC ATGGTTATTTCATACC TATACT ATGGTTATTTCATAC TATGGT TATTTCATAC TATGCT ATGGTTATTTCATAC TATAAT GCACTAAATGGTGC GATCAT ACGCCGTTATACGTT AATAAT TCGGATTGCTAAGTA TTTAAT AATTCGGATTGCTAAGTA TAAAAG TTATGAAGTCGGT TATAAT GCGTAAAAGTTATGAAGTCGGT TATACT GTTCGCCGTTGTCC TAAGAT GCATTTGAGATACAT TATACT TATTTGCGAACATTCCA TTTCTC TGGTCACCAGCCGGGAA CCCCAT TTCTCTGGTCACCAGCCGGGAA TAAAAT AACGGATTAACCCAAGT TAGGTT AAAAGACATCAGTTGAA CATCAT TGTACAATGAACTGTAC CATTGT ACAATGAACTGTAC TACAAT GAACTGTAC CATTAT CTTACGTGATCAG GATAGT CGCATCGGATCTG CACGAT AGTCGCATCGGATCTG TATGAT TGAACCCGCATGGCTC TATACT CTTTCCTGCAATGGTT TCTGAT AAAACAGTGAATG TAAAAT CACGGTCTGATAAAACAGTGAATG TAAAAC AGTGAATGATAACCTCGT TAACTC TTTAGGCATTCCTTCGA TAACTC TTTAGGCATTCCTTCGA TAGGCA TTCCTTCGA TAATGT GTTTTACACATTTTTTC TATTCT TATTACCCCGTGT TCTTAT TACCCCGTGT TAAGTT GTGGGATTCAGCCGATT TAGGAT TAATTAAAAAAATAGAG TATGAT GGTGTTTTTGAGGTGCT TAGTGT TTTATGTTCAGATAAT TTTTAT GTTCAGATAAT TAGTAT TAAGACTATCACTTATT CATGAT AGCGCCCGGAAGAGAGT TATGTT GTGTGGAATTGTGAGC TATTGT GAGCGGATAACAATTT TATTGT GAGCGGATAACAATTT TATGTT GTGTGGTATTGTGAGCGGATAACAATTT TACACT TTATGCTTCCGGCTCG TACACT TTATGCTTCCGGCTCG TATGCT TCCGGCTCG TATAAT TGTTATCTAAGGAAAT TACACT ATAGGTGTGGTTTAAT TAAAAT AGCCAACCTGTTCGACA TGTACT TGACACTTCAGGAGTG GATACT GAGCACATCAGCAGGA CATAAT GACTCCTGTTGATAGAT GATAAT GGTTGCATGTACTAAG TAAATT TGACTCAACGATGGGTT TATTTC CTTAGATAACAAT AAGTAT TTCCTTAGATAACAAT TAGATT TAACGTATGAGCACAA TCTATT AATACAGACGTTAAT TAACTC TAAAAGCATATCGCATT TAGAAT GCGCCTCCGTGGTAGCA TATACT CACAGCATAACTGTAT TATGTT TTAGCAGAGTATGCT TAAAAT ACCGACGGATAGAACGA TAATAC TTGTAACGCTACATGGA AATACT TGTAACGCTACATGGA TATACT TGTAACGCTACATGGA TATAAT TGTAACGCTACATGGA GTAATA CTTGTAACGCTACATGGA TAATAC TTGTAACGCTACATGGA TATACT GCGCGCCGAAGCTGACC TATGTT GTGTGGAATTGTGAGC TATGTT GTGTGGAATTGTGAGC TATGTT GTGTGGAATTGTGAGC TATGTT GTGTGGAATTGTGAGCG TATATT GTGTGGAATTGTGAGCG GAAACT AGAGTCCGTTTAGGTGT CATAGT CAGCCCATCATGAATG

Tabla A.3: Descripci´ on de los promotores de la base de datos utilizada en la experimentaci´ on.

166

´ APENDICE A. TABLAS Y FIGURAS ADICIONALES

TTGACA TATAAT Promotor secuencia malPQ 15 38 ATCCCCGCAGGATG AGGAAG GTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT malPQ/A516P1 12 34 ATCCCCGCAGG ATGAGG AGCCTGGC AAACTAGC GATGAT AACGTTGTGTTGAA 15 39 ATCCCCGCAGGAGG ATGAGG AGCCTGGCA AACTAGCGA TAACGT TGTGTTGAAAA malPQ/A516P2 15 37 CCCCGCAGGATGAG GTCGAG CCTGGCAA ACTAGCGA TAACGT TGTGTTGAAAA malPQ/A517/A 14 37 ATCCCCGCAGGAT GAGGAA GGTCAACA TCGAGCCTG GAAAAC TAGCGATAACGTTGTGT malPQ/Pp12 14 38 ATCCCCGCAGGAT GAGGAA GGTCAACA TCGAGCCTGG AAAACT AGCGATAACGTTGTGT malPQ/Pp12 14 38 ATCCCCGCAGGAT TAGGAA GGTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT malPQ/Pp13 15 38 ATCCCCGCAGGATT AGGAAG GTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT malPQ/Pp13 14 37 ATCCCCGCAGGAT GAGGAA GGTCAACA TCGAGCCTG GAAACT AGCGATAACGTTGTGT malPQ/Pp14 malPQ/Pp15 14 38 ATCCCCGCAGGAT GAGAAA GGTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT 15 38 ATCCCCGCAGGATA AGGAAG GTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT malPQ/Pp16 15 38 ATCCCCGCAGGATG GGGAAG GTCAACAT CGAGCCTGG CAAACT AGCGATAACGTTGTGT malPQ/Pp18 15 37 GTCATCGCTTGCAT TAGAAA GGTTTCTG GCCGACCT TATAAC CATTAATTACG malT malT 9 32 GTCATCGC TTGCAT TAGAAAGGT TTCTGGCC GACCTT ATAACCATTAATTACG 15 38 CGGCTCCAGGTTAC TTCCCG TAGGATTC TTGCTTTAA TAGTGG GATTAATTTCCACATTA manA 10 33 CGGCTCCAG GTTACT TCCCGTAG GATTCTTGC TTTAAT AGTGGGATTAATTTCCACATTA manA 15 38 TTCAACATGCAGGC TCGACA TTGGCAAA TTTTCTGGT TATCTT CAGCTATCTGGATGT metA-P1 metA-P2 15 38 AAGACTAATTACCA TTTTCT CTCCTTTT AGTCATTCT TATATT CTAACGTAGTCTTTTCC 17 40 AAGACTAATTACCATT TTCTCT CCTTTTAG TCATTCTTA TATTCT AACGTAGTCTTTTCC metA-P2 12 35 TTACCGTGACA TCGTGT AATGCACC TGTCGGCGT GATAAT GCATATAATTTTAACGG metBL 20 44 TTACCGTGACATCGTGTAA TGCACC TGTCGGCGT GATAATGCA TATAAT TTTAACGG metBL 8 31 TTTTCGG TTGACG CCCTTCGG CTTTTCCTT CATCTT TACATCTGGACG metF 15 37 GCGGAATGGCGAAA TAAGCA CCTAACAT CAAGCAAT AATAAT TCAAGGTTAAAATCAAT micF 27 50 GCGGAATGGCGAAATAAGCACCTAAC ATCAAG CAATAATA ATTCAAGGT TAAAAT CAAT micF 15 39 GCCCCAATCGCGCG TTAACG CCTGACGAC TGAACATCC TGTCAT GGTCAACAGTGGA motA MuPc-1 6 33 AAATT TTGAAA AGTAACTTTATAGAAAAGAAT AATACT GAAAAGTCAATTTGGTG 6 30 AAATT TTGAAA AGTAACTTT ATAGAAAAG AATAAT ACTGAAAAGTCAATTTGGTG MuPc-1 18 40 AAATTTTGAAAAGTAAC TTTATA GAAAAGAA TAATACTG AAAAGT CAATTTGGTG MuPc-1 9 32 GGAACACA TTTAAA AACCCTCC TAAGTTTTG TAATCT ATAAAGTTAGCAATTTA MuPc-2 MuPc-2 9 30 GGAACACA TTTAAA AACCCTC CTAAGTTT TGTAAT CTATAAAGTTAGCAATTTA 15 38 TACCAAAAAGCACC TTTACA TTAAGCTT TTCAGTAAT TATCTT TTTAGTAAGCTAGCTA MuPe 15 39 GTCACAATTCTCAA GTCGCT GATTTCAAA AAACTGTAG TATCCT CTGCGAAACGATCCCT NR1rnaC 16 39 GTCACAATTCTCAAG TCGCTG ATTTCAAA AAACTGTAG TATCCT CTGCGAAACGATCCCT NR1rnaC NR1rnaC/m 15 38 TCACAATTCTCAAG TTGCTG ATTTCAAA AAACTGTAG TATCCT CTGCGAAACGATCCCT 11 35 GGAGTTTGTC TTGAAG TTATGCACC TGTTAAGGC TAAACT GAAAGAACAGATTTTGT NVP1rna100 7 30 CAGTAT TTGCAT TTTTTACC CAAAACGAG TAGAAT TTGCCACGTTTCAGGCG nusA 12 34 GCCTGACGGAG TTCACA CTTGTAAG TTTTCAAC TACGTT GTAGACTTTAC ompA 13 34 GCCTGACGGAGT TCACAC TTGTAAG TTTTCAAC TACGTT GTAGACTTTAC ompA 19 41 GCCTGACGGAGTTCACAC TTGTAA GTTTTCAA CTACGTTG TAGACT TTAC ompA 15 38 GTATCATATTCGTG TTGGAT TATTCTGC ATTTTTGGG GAGAAT GGACTTGCCGACTG ompC 7 30 GGTAGG TAGCGA AACGTTAG TTTGAATGG AAAGAT GCCTGCAGACACATAAA ompF ompF 22 45 GGTAGGTAGCGAAACGTTAGT TTGAAT GGAAAGAT GCCTGCAGA CACATA AA 3 26 GG TAGCGA AACGTTAG TTTGCAAGC TTTAAT GCGGTAGTTTATCAC ompF/pKI217 18 41 GGTAGCGAAACGTTAGT TTGCAA GCTTTAAT GCGGTAGTT TATCAC ompF/pKI217 15 36 TTTCGCCGAATAAA TTGTAT ACTTAAG CTGCTGTT TAATAT GCTTTGTAACAATTT ompR 15 39 TTTCGCCGAATAAA TTGTAT ACTTAAGCTG CTGTTTAA TATGCT TTGTAACAATTT ompR p15primer 15 38 ATAAGATGATCTTC TTGAGA TCGTTTTG GTCTGCGCG TAATCT CTTGCTTGAAAACGAAA 15 39 TAGAGGAGTTAGTC TTGAAG TCATGCGCC GGTTAAGGC TAAACT GAAAGGACAAGTTTTG p15rnaI 15 38 TCCAAGTTAGTGTA TTGACA TGATAGAA GCACTCTAC TATATT CTCAATAGGTCCACGG P22ant P22mnt 15 38 CCACCGTGGACCTA TTGAGA ATATAGTA GAGTGCTTC TATCAT GTCAATACACTAACTT 15 37 CATCTTAAATAAAC TTGACT AAAGATTC CTTTAGTA GATAAT TTAAGTGTTCTTTAAT P22PR 9 32 AAATTATC TACTAA AGGAATCT TTAGTCAAG TTTATT TAAGATGACTTAACTAT P22PRM 15 38 AAATTATCTACTAA AGGAAT CTTTAGTC AAGTTTATT TAAGAT GACTTAACTAT P22PRM 24 47 AAATTATCTACTAAAGGAATCTT TAGTCA AGTTTATT TAAGATGAC TTAACT AT P22PRM 12 35 AATTCTCATGT TTGACA GCTTATCA TCGATAAGC TAGCTT TAATGCGGTAGTTTAT pBR313Htet 15 38 TTTTTCTAAATACA TTCAAA TATGTATC CGCTCATGA GACAAT AACCCTGATAAATGCT pBR322bla 15 42 CATCTGTGCGGTAT TTCACA CCGCATATGGTGCACTCTCAG TACAAT CTGCTCTGATGCCGCAT pBR322P4 pBR322primer 15 38 ATCAAAGGATCTTC TTGAGA TCCTTTTT TTCTGCGCG TAATCT GCTGCTTGCAAACAAAA 15 38 AAGAATTCTCATGT TTGACA GCTTATCA TCGATAAGC TTTAAT GCGGTAGTTTATCACA pBR322tet 4 27 TCG TTTTCA AGAATTCA TTAATGCGG TAGTTT ATCACAGTTAA pBRH4-25 15 42 TTCATACACGGTGC CTGACT GCGTTAGCAATTTAACTGTGA TAAACT ACCGCATTAAAGCTTA pBRP1 15 39 GTGCTACAGAGTTC TTGAAG TGGTGGCCT AACTACGGC TACACT AGAAGGACAGTATTTG pBRRNAI pBRtet-10 15 38 AAGAATTCTCATGT TTGACA GCTTATCA TCGATGCGG TAGTTT ATCACAGTTAA 15 38 AAGAATTCTCATGT TTGACA GCTTATCA TCGGTAGTT TATCAC AGTTAAATTGC pBRtet-15 15 39 AAGAATTCTCATGT TTGACA GCTTATCAT CGATCACAG TTAAAT TGCTAACGCAG pBRtet-22 10 33 TTCTCATGT TTGACA GCTTATCA TCGATAAGC TAAATT TTATATAAAATTTAGCT pBRtet/TA22 pBRtet/TA33 10 33 TTCTCATGT TTGACA GCTTATCA TCGATAAGC TAAATT TATATAAAATTTTATAT 15 38 TCACAATTCTCAAG TTGATA ATGAGAAT CATTATTGA CATAAT TGTTATTATTTTAC pColViron-P1 13 35 TGTTTCAACACC ATGTAT TAATTGTG TTTATTTG TAAAAT TAATTTTCTGACAATAA pColViron-P2 6 30 CTGGC TGGACT TCGAATTCA TTAATGCGG TAGTTT ATCACAGTTAA pEG3503 15 38 AATAACCGTCAGGA TTGACA CCCTCCCA ATTGTATGT TTTCAT GCCTCCAAATCTTGGA phiXA 15 39 GCCAGTTAAATAGC TTGCAA AATACGTGG CCTTATGGT TACAGT ATGCCCATCGCAGTT phiXB 15 39 TAGAGATTCTCTTG TTGACA TTTTAAAAG AGCGTGGAT TACTAT CTGAGTCCGATGCTGTT phiXD pori-I 15 38 CTGTTGTTCAGTTT TTGAGT TGTGTATA ACCCCTCAT TCTGAT CCCAGCTTATACGGT 15 39 GATCGCACGATCTG TATACT TATTTGAGT AAATTAACC CACGAT CCCAGCCATTCTTCTGC pori-r 15 38 CGATTTCGCAGCAT TTGACG TCACCGCT TTTACGTGG CTTTAT AAAAGACGACGAAAA ppc 3 30 TT TTGTAG AGGAGCAAACAGCGTTTGCGA CATCCT TTTGTAATACTGCGGAA pSC101oriP1 8 30 ATTATCA TTGACT AGCCCATC TCAATTGG TATAGT GATTAAAATCACCTAGA pSC101oriP2 15 38 ATACGCTCAGATGA TGAACA TCAGTAGG GAAAATGCT TATGGT GTATTAGCTAAAGC pSC101oriP3 pyrB1-P1 15 37 CTTTCACACTCCGC CCTATA AGTCGGAT GAATGGAA TAAAAT GCATATCTGATTGCGTG 3 26 CT TTCACA CTCCGCCC TATAAGTCG GATGAA TGGAATAAAATGCATATCTGATTGCGTG pyrB1-P1 13 36 TTGCATCAAATG CTTGCG CCGCTTCT GACGATGAG TATAAT GCCGGACAATTTGCCGG pyrB1-P2

Tabla A.4: Descripci´ on de los promotores de la base de datos utilizada en la experimentaci´ on.

167 TTGACA TATAAT Promotor secuencia pyrD 15 38 pyrE-P1 15 38 14 38 pyrE-P2 15 39 R100rna3 15 38 R100RNAI 15 38 R100RNAII 15 37 R1RNAII 15 37 recA 15 38 rnh rnh 12 33 15 38 rn(pRNaseP) 15 38 rp1J 15 38 rpmH1p rpmH1p 16 38 15 38 rpmH2p 15 38 rpmH3p 15 38 rpoA rpoB 15 37 13 36 rpoD-Pa 9 33 rpoD-Pb 12 36 rpoD-Pb 13 36 rpoD-Phs 4 31 rpoD-Phs/min 4 27 rpoD-Phs/min 12 36 rpoD-Phs/min rrn4.5S 14 37 15 37 rrnABP1 15 37 rrnABP2 14 40 rrnB-P3 rrnB-P4 15 36 15 37 rrnDEXP2 15 37 rrnD-P1 15 37 rrnE-P1 rrnG-P1 15 37 15 37 rrnG-P2 15 37 rrnX1 15 38 RSFprimer 15 39 RSFrnaI 15 37 S10 14 37 sdh-P1 15 37 sdh-P2 spc 15 38 15 37 spot42r 14 37 spot42r 15 39 ssb 15 38 str sucAB 15 39 15 38 supB-E 15 38 T7-A1 T7-A3 15 38 15 38 T7-C 15 38 T7-D 15 39 T7A2 11 34 T7E 10 32 TAC16 9 33 Tn10Pin 15 38 Tn10Pin Tn10Pout 15 38 15 39 Tn10tetA 15 39 Tn10tetR 11 34 Tn10tetR* 15 37 Tn10xxxP1 Tn10xxxP2 15 38 11 38 Tn10xxxP3 19 43 Tn10xxxP3 15 38 Tn2660bla-P3 Tn2661bla-Pa 15 38 5 28 Tn2661bla-Pb 14 39 Tn501mer 15 37 Tn501merR 8 32 Tn501merR 15 38 Tn5TR 15 38 Tn5neo Tn7-PLE 15 38 15 37 tnaA 15 39 tonB 15 39 trfA 15 38 trfB 15 38 trp trpP2 15 38 15 39 trpR 11 34 trpR

TTGCCGCAGGTCAA ATGCCTTGTAAGGA GTAGGCGGTCATA GTACCGGCTTACGC CACAGAAAGAAGTC ATGGGCTTACATTC ACTAAAGTAAAGAC TTTCTACAAAACAC GTAAGCGGTCATTT GTAAGCGGTCA ATGCGCAACGCGGG TGTAAACTAATGCC GATCCAGGACGATC GATCCAGGACGATCC ATAAGGAAAGAGAA AAATTTAATGACCA TTCGCATATTTTTC CGACTTAATATACT CGCCCTGTTCCG AGCCAGGT AGCCAGGTCTG ATGCTGCCACCC CCC CCC CCCTTGAAAAA GGCACGCGATGGG TTTTAAATTTCCTC GCAAAAATAAATGC CTATGATAAGGAT GCGTATCCGGTCAC CCTGAAATTCAGGG GATCAAAAAAATAC CTGCAATTTTTCTA TTTATATTTTTCGC AAGCAAAGAAATGC ATGCATTTTTCCGC GGAATAGCTGTTCG TAGAGGAGTTTGTC TACTAGCAATACGC ATATGTAGGTTAA AGCTTCCGCGATTA CCGTTTATTTTTTC TTACAAAAAGTGCT TTACAAAAAGTGC TAGTAAAAGCGCTA TCGTTGTATATTTC AAATGCAGGAAATC CCTTGAAAAAGAGG TATCAAAAAGAGTA GTGAAACAAAACGG CATTGATAAGCAAC CTTTAAGATAGGCG ACGAAAAACAGGTA CTTACGGATG AATGAGCTG TCATTAAG TCATTAAGTTAAGG AGTGTAATTCGGGG ATTCCTAATTTTTG TATTCATTTCACTT TGATAGGGAG TTAAAATTTTCTTG AAATGTTCTTAAGA CCATGATAGA CCATGATAGATTTAAAAT TTTTTCTAAATACA GGTTTATAAAATTC CCTC TTTTCCATATCGC CATGCGCTTGTCCT CATGCGC TCCAGGATCTGATC CAAGCGAACCGGAA ACTAGACAGAATAG AAACAATTTCAGAA ATCGTCTTGCCTTA AGCCGCTAAAGTTC AGCGGCTAAAGGTG TCTGAAATGAGCTG ACCGGAAGAAAACC TGGGGACGTCGTTA TGGGGACGTC

TTCCCT TAGGAA CTGCGG CGGGCT TTGAAC TTGAGT TTTACT TTGATA ATGTCA TTTATG GTGACA TTTACG CTTGCG TTGCGC TTGACT TAGACA TTGCAA GCGACA CAGCTA CTGACC ACCACC TTGAAA TTGAAA TTGAAA CTGTCG TTGCAA TTGTCA TTGACT TACTCA CTCTCA TTGACT TTGTGC TTGCGG TTGTCA TTGACT TTGTCT TTGACT TTGAAG TTGCGT TTGTAA TGGGCA TACCCA TTCTGA TTTCTG TTGGTA TTGACA TTTAAA TTGACG TTGACT TTGACA TTGACG TTGACT TTGACA ATGATA TTGACA TTAAGG TGGATA CAGAAT TTGACA TTCTCT TGGTAA TTGATG TTGTCA TTTAAA AACATA TTCAAA TTGAAG GTGATA TTGACT TTCGAA TTGTCC TTCCAT TTGCCA TTGTAA TAGACA TTGAAT TTGACA TTGACG TTGACA GTGACA CTGATC GTTACT

TTTGGTCC GAACTCGCA TAACCGCC GGAAGTCCG ATCATAGAC GTTCCTGTT TCGGCGGTT TTACTCCTG TTTTCCGG GCATATAAC GTTCAGAA GATTAGTGC TTGTGGCG TAGCATGC CTGTATGA GCATACAG GACTTGTC GTTTTACAG TCAGACT TGTCGTTT AGGGCGCG CAAACCCTC TGGGCGGT GATTTTGTC CTTTACCC ATCAGCCCG TTTACCC ATCAGCCCG CCGGAGTG TACAATTAT AAAATTGG CTTAATCGA AGTTGGGT TGAGCTGGC GGACGTCC GTTCTGTG AAACGCAC GACCATGCG ACCGGGCAA CTTTTAGAG GGGCAACTT TTAGAGCAC AACTGTCG ATGTGGGAC AACTGTCGATGTGGGACGATA AACTGTCGA TGTGGGAC ATGT GGGAC TTAGCCGG GGCAGCAGT GGCCGGAA TAACTCCC CTGTAGCG GGAAGGCG TCTTATCCTT ATCAAACCGT CCTGACA GTTCGTGG CTGAAAGA GGAAAGCG AAAAAATT GGGATCCC CCTGCGGA GAACTCCC GGCCGGAA TAACTCCC CTGTAGCG GGAAGGCG TCCTGAGC CGACTCCC TGATAGAC CGATTGATT TTATGCACC TGTTAAGGC TCGGTGGT TAAGTATG TGATTTTG TGAACAGCC GCTTCTTC GTCAAATT TATCCTTG AAGCGGTGT ACTGAACA AAAAAGAG AACTGAACA AAAAAGAG ATGGTACAA TCGCGCGTT CCTTTTCG GCATCGCCC AACTGCCCC TGACACTAA CTGCAAGG CTCTATACG TAAAGTCT AACCTATAG ACATGAAG TAAACACGG CAATGTTA ATGGGCTGA TGATGGGT CTTTAGGTG ACATGAAGT AACATGCAG TTTACACA TTACAGTGA ATTAATCA TCGGCTCG TGGATACAC ATCTTGTCA CACATCTT GTCATATGA TGGTAAAG AGAGTCGTG CTCTATCAT TGATAGAGT ATCACTGAT AGGGAGTGG AATAACTC TATCAATGA ATTTTTAT TTCCATGA CGACCACA TCATCATGA ATAACATACCGTCAGTATGTT CCGTCAGTA TGTTTATGG TATGTATC CGCTCATGA ACGAAAGG GCCTCGTGA CGCTTATT TTTATAGGT CCGTACATG AGTACGGAAG TTGAAATT GGATAGCG TTTCGAATT GAAATTGGA GTGACCTC CTAACATGG GCTGGGGC GCCCTCTGG ACTGAAAT CAGTCCAGT AAAACTCT GAGTGTAA ATGATTGCT ATTTGCATT GCGGAACCA ATGTTTAGC TGCGAGAA ATGTTTAGC ATTAATCA TCGAACTAG TTTTAACA CGTTTGTTA CGCACGTTT ATGATATGC GATCCGCAC GTTTATGA

CATAAT TATAAT TATAAA TATCAT TATACT TAGATT TAGATT TATAAT TTCGAT TACAGT TATACT TACAAT TATAAT TATAAT TACAAT TCTAAT TAGATT TAAATC TATACT CACTAT TATCGT GATATA TAGCAG GATATA GATATA GATAAT TATAAT TATTAT TAAAAT TAAAAT TAATAT TATAAT TATAAT TATAAT TATTAT TATAAT CATCAT TAAACT TATAAT TATACT TATCAT TATAAT TAAAGT TAAAGT TACACT TAAAAT GACAGT CATAAT GATACT TACGAT TAGTCT TAGGCT TAAGAT TATACT TATAAT TATGAT TCAAAT TAAAAT TATTTT TAAAAT TAGAGT TAGATT TACCAT TATGGT TATCAT GACAAT TACGCT TAATGT TAAGGT TAACCT TAGCGT TAACGT TAAGGT TATGCT TAATGT TAAAAT TAAACT TAAACT TTAACT CAAGGT TATCGT TATGCT

ACGCCCCCGGTTTG GCGCAGCCACATTTG AGGAGAGGTGGAAGG ATGAAACAACAGAG CCCCGCATAGCTGAAT ACTGATCGTTTAAGGAA ACTGATCGTTTAAGGAA TGCTTCAACAGAACAT TCAATTACAGGA TCGATTCAATTACAGGA GCGCGCCGAAGCTGACC CTTACCCCCACGTATA CCTCCACCCGGCGCG CCTCCACCCGGCGCG CCGGCCTCTTTAATC AAAGATCCCAGGACG AGCCAGCCAATCTTT GCAATGAAATGGTTTAA TATAGGGTTGC CGTGGTACAAAT GGTACAAAT GCAGATAAGAA ATAAGAATATTGCT GCAGATAAGAATATTGCT GCAGATAAGAATATTGCT GCGCCTGCGCGTTGGTT GCGCCACCACTGACACG GCACACCCCGCGCCGC GGGCGGTGTGAGCTTG AGCCAACCTGTTCGACA ACGCCACCTCGCGACAG GCGCCTCCGTTGAGACG GCGCCTCCATCGACACG GCGCCACCACTGACACG GCACACCGCCGCGCCG GCGCCTCCATCGACACG CTCATAAATAAAGAA GAAAGAACAGATTTTG GCGCGGGCTTGTCGT GCCGCCAGTCTCCGGAA GTGGGGCATCCTTACCG GCCGCGCCCTCGATA TAGTCGCGTAGGGTACA TAGTCGCGTAGGGTACA TATTCAGAACGATTTT TCGGCGTCCTCATAT TTTAAAAGGTTCCTT GCGCCCCGCAACGCCGA TACAGCCATCGAGAGGG GTACCACATGAAACGAC TATCTTACAGGTCATC TTAGGTGTTGGCTTTA ACAAATCGCTAGGTAAC CAAGGCCACTACAGATA GTGTGGAATTGTG CAAATGGTTTCGCGAAA GGTTTCGCGAAA ATCGAGTTCGCACATC ACCACTCCCTATCAGT AACTCTATCAATGATA GTCAACAAAAATTAGG TAAAATAACATACC AAACATACTGACGG ATCATGATGATGTGGTC GATGATGTGGTC AACCCTGATAAATGCT TATTTTTATAGGTTAA CATGATAATAATGGTTT TACGCTATCCAATTTC TACTTCCGTACTCA AACCTTACTTCCGTACTCA TCATGATAACTTCTGCT TGGGAAGCCCTGCAA GTGAAAAAGCAT AGCCTCGTGTCTTGCG CGAGACCTGGTTT AGAGTCTCCTT TCTCTCATGTG AGTACGCAAGTTCACGT AAAGGCGACGCCGCCC ACTCTTTAGCGAGTACA ATCGTACTCTTTAGCGAGTACA

Tabla A.5: Descripci´ on de los promotores de la base de datos utilizada en la experimentaci´ on.

´ APENDICE A. TABLAS Y FIGURAS ADICIONALES

168

1 6 7 8 10 12 13 14 16 16 58 736 673 805 510 454 89 179 256 380 536 607 759 451 864 905 74 433 684

15 20 22 1

54 80 144 167 207 337 366 691 695 708 804 811 816 821 831 913 413 604 688 803

17 24 21 340 363 500 824 42 82 259 267 299 317 457 467 501 507 228 258 302 325 559 588

17

3

···

57

0

···

3e-04

24 21 721 809 841 891

Figura A.1: Intersecci´ on de ClustersA y ClustersB para CC-EMO. El gr´ afico representa cada intersecci´ on como un c´ırculo, cuyo tama˜ no crece con la cantidad de elementos en la intersecci´ on entre los clusters, mientras que el color muestra el p-value de la intersecci´ on.

Bibliograf´ıa

[1] R. Agrawal, T. Imielinski, y A. Swami. Mining association rules between sets of items in large databases. En P. Buneman y S. Jajodia, editores, Proceedings of the 1993 ACM SIGMOD International Conference on Management of Data, p´ aginas 207–216, Washington, D.C., 1993. [2] R. Agrawal, H. Mannila, R. Srikant, H.Toivonen, y A.I. Verkamo. Fast discovery of association rules. En Advances in Knowledge Discovery and Data Mining, p´ aginas 307–328. AAAI/MIT Press, 1996. [3] A.V. Aho, J.E. Hopcroft, y J.D. Ullman. Data Structures and Algorithms. Addison-Wesley Series in Computer Science and Information Processing. Addison-Wesley, 1982. [4] F. Al-Shahrour, R. D´ıaz-Uriarte, y J. Dopazo. Fatigo: a web tool for finding significant associations of gene ontology terms with groups of genes. Bioinformatics, 20:578–580, 2004. [5] B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts, y P. Walter. Biolog´ıa molecular de la c´elula. Cuarta Edici´ on. Omega, 2003. [6] C. Alfarano, C.E. Andrade, K. Anthony, N. Bahroos, M. Bajec, K. Bantoft, D. Betel, B B. obechko, K. Boutilier, E. Burgess, K. Buzadzija, R. Cavero, C. D’Abreo, I. Donaldson, Dorair D. ajoo, M.J. Dumontier, M.R. Dumontier, V. Earles, R. Farrall, H. Feldman, E. Garderman, Gon Y. g, R. Gonzaga, V. Grytsan, E. Gryz, V. Gu, E. Haldorsen, A. Halupa, R. Haw, Hrvojic A., L. Hurrell, R. Isserlin, F. Jack, F. Juma, A. Khan, T. Kon, S. Konopinsky, V. Le, Lee E., S. Ling, M. Magidin, J. Moniakis, ˜ Paraiso J.P., B. Parker, G. PinJ. Montojo, S. Moore, B. Muskat, I.Ng, tilie, R. Pirone, J.J. Salama, S. Sgro, T. Shan, Y. Shu, J. Siew, Sk D. inner, K. Snyder, R. Stasiuk, D. Strumpf, B. Tuekam, S. Tao, Z. Wang, M. White, Willis R., C. Wolting, S. Wong, A. Wrong, C. Xin, R. Yao, 169

170

BIBLIOGRAF´IA B. Yates, S. Zhang, K. Zheng, Pawson T., B.F.F. Ouellette, y C.W.V. Hogue. The Biomolecular Interaction Network Database and related tools 2005 update. Nucl. Acids Res., 33(suppl 1):D418–424, 2005.

[7] D. Andre. Learning and upgrading rules for an OCR system using genetic programming. En Proceedings of the 1994 IEEE World Congress on Computational Intelligence, Orlando, Florida, USA, 27-29 Junio 1994. IEEE Press. [8] M. Ashburner, C.A. Ball, J.A. Blake, D. Botstein, H. Butler, J.M. Cherry, A.P. Davis, K. Dolinski, S.S. Dwight, J.T. Eppig, M.A. Harris, D.P. Hill, L. Issel-Tarver, A. Kasarskis, S. Lewis, J.C. Matese, J.E. Richardson, M. Ringwald, G.M. Rubin, y G. Sherlock. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nature Genet., 25:25–29, 2000. [9] T.K. Attwood y D.J. Parry-Smith. Introducci´ on a la Bioinform´ atica. Prentice Hall, 2002. [10] R. Babuska. Fuzzy Modeling for Control. Kluwer Academic Publishers, Norwell, MA, USA, 1998. [11] T. Back, D. Fogel, y Z. Michalewicz, editores. Handbook of Evolutionary Computation. IOP Publishing Ltd., Bristol, UK, 1997. [12] W. Banzhaf, P. Nordin, R. Keller, y F. Francone. Genetic Programming – An Introduction; On the Automatic Evolution of Computer Programs and its Applications. Morgan Kaufmann, Enero 1998. [13] A. Barnard, A. Wolfe, y S. Busby. Regulation at complex bacterial promoters: how bacteria use different promoter organizations to produce different regulatory outcomes. Curr Opin Microbiol, 7:102–108, 2004. [14] E. Ben´ıtez-Bell´ on, G. Moreno-Hagelsieb, y J. Collado-Vides. Evaluation of thresholds for the detection of binding sites for regulatory proteins in Escherichia coli K12 DNA. Genome Biology, 3(3):research0013.1 – 0013.16, 2002. [15] W.A. Bennage y A.K. Dhingra. Single and multiobjective structural optimization in discrete-continuous variables using simulated annealing. International Journal for Numerical Methods in Engineering, 38:2753–2773, 1995. [16] D.A. Benson, I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, y D.L. Wheeler. GenBank. Nucleics Acids Research, 31(1):23–27, 2003. [17] J. Berg, J. Tymoczko, y Lubert L. Stryer. Bioqu´ımica. Quinta Edici´ on. Reverte, 2003.

BIBLIOGRAF´IA

171

[18] J. Bezdek. Fuzzy clustering. En E. Ruspini, P. Bonissone, y W. Pedrycz, editores, Handbook of Fuzzy Computation. Institute of Physics Press, 1998. [19] J.C. Bezdek y S.K. Pal, editores. Fuzzy Models for Pattern Recognition. IEEE Press, New York, 1992. [20] D.J. Cavicchio. Adaptive search using simulated evolution. PhD thesis, University of Michigan, 1970. [21] A. Charnes y W.W. Cooper. Management Models and Industrial Applications of Linear Programming Vol. 1. John Wiley & Sons, New York, 1961. [22] C. Coello-Coello, D. Van Veldhuizen, y G. Lamont. Evolutionary Algorithms for Solving Multi-Objective Problems. Kluwer, 2002. [23] J.L. Cohon. Multiobjective Programming and Planning. Academic Press, New York, 1978. [24] F.S. Collins, M. Morgan, y A.A. Patrinos. The human genome project: Lessons from large-scale biology. Science, 300(5617):286–290, 2003. [25] D. Cook, L. Holder, S. Su, R. Maglothin, y I. Jonyer. Structural mining of molecular biology data. IEEE Engineering in Medicine and Biology, special issue on Advances in Genomics, 4(20):67–74, 2001. [26] O. Cord´ on, F. Herrera, F. Hoffmann, y L. Magdalena. Genetic Fuzzy Systems. Evolutionary Tuning and Learning of Fuzzy Knowledge Bases. Advances in Fuzzy Systems - Applications and Theory. Vol. 19. World Scientific, 2001. [27] O. Cord´ on, E. Herrera-Viedma, y M. Luque. Evolutionary learning of boolean queries by multiobjective genetic programming. En Seventh International Conference on Parallel Problem Solving from Nature PPSN VII 2002, number 2439 in Lecture Notes in Computer Science, p´ aginas 710–719, Granada, Spain, 2002. [28] O. Cord´ on, E. Herrera-Viedma, y M. Luque. Improving the learning of boolean queries by means of a multiobjective IQBE evolutionary algorithm. Information Processing and Management, 2005. In press. [29] V. Cotik, R. Romero-Zaliz, y I. Zwir. A hybrid promoter anaysis methodology for prokaryotic genomes. Special issue on “Bioinformatics”, Fuzzy Sets and Systems, 152:83–102, 2005. [30] J.M. Daida, T.F. Bersano-Begey, S.J. Ross, y J.F. Vesecky. Computerassisted design of image classification algorithms: Dynamic and static fitness evaluations in a scaffolded genetic programming environment. En

172

BIBLIOGRAF´IA John R. Koza, David E. Goldberg, David B. Fogel, y Rick L. Riolo, editores, Genetic Programming 1996: Proceedings of the First Annual Conference, p´ aginas 279–284, Stanford University, CA, USA, 28–31 Julio 1996. MIT Press.

[31] C. Darwin. On The Origin of Species by Means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life. John Murray, London, 1859. [32] K. De Jong. An analysis of the behaviour of a class of genetic adaptive systems. PhD thesis, University of Michigan, 1975. [33] K. Deb. Multi-Objective Optimization Using Evolutionary Algorithms. John Wiley & Sons, Inc., 2001. [34] K. Deb, A. Pratap, S. Agarwal, y T. Meyarivan. A fast and elitist multiobjective genetic algorithm: NSGA-II. IEEE Transactions on Evolutionary Computation, 6:182–197, 2002. [35] G. Der y B.S. Everitt. A handbook of statistical analyses using SAS. CHAPMAN-HALL, 1996. [36] R.O. Duda, P.E. Hart, y D.G. Stork. Pattern Classification (2nd Edition). Wiley-Interscience, 2000. [37] T.E. Dunning y M.W. Davis. Evolutionary algorithms for natural language processing. En John R. Koza, editor, Late Breaking Papers at the Genetic Programming 1996 Conference Stanford University July 28-31, 1996, p´ aginas 16–23, Stanford University, CA, USA, 28–31 Julio 1996. Stanford Bookstore. [38] C.M. Fonseca y P.J. Fleming. On the performance assesment and comparison of stochastic multiobjective optimizers. En Fourth International Conference on Parallel Problem Solving from Nature (PPSN-IV), p´ aginas 584–593, Berlin, Alemania, 1996. Springer. [39] A. Freitas. Data Mining and Knowledge Discovery with Evolutionary Algorithms. Springer-Verlag, 2002. [40] A.P. Gasch y M.B. Eisen. Exploring the conditional coregulation of yeast gene expression through fuzzy k-means clustering. Genome Biology, 3, 2002. [41] S.I. Gass y T.L. Saaty. The computational algorithm for the parametric objective function. Naval Research Logistics Quarterly, 2:39, 1955. [42] D. Goldberg. Genetic Algorithms in Search Optimization and Machine Learning. Addison-Wesley, 1989.

BIBLIOGRAF´IA

173

[43] D. Goldberg y J.J. Richardson. Genetic algorithms with sharing for multimodal function optimization. En Proceedings Second International Conference on Genetic Algorithm, p´ aginas 41–49, 1987. [44] J. Grefenstette. Genetic algorithms for machine learning. Kluwer, 1993. [45] D. Hand, H. Mannila, y P. Smyth. Principles of Data Mining. MIT Press, 2001. [46] S. Handley. Automatic learning of a detector for alpha-helices in protein sequences via genetic programming. En Proceedings of the 5th International Conference on Genetic Algorithms, ICGA-93, p´ aginas 271–278. Morgan Kaufmann, 1993. [47] A.E. Hans. Multicriteria optimization for highly accurate systems. Multicriteria Optimization in Engineering and Sciences, 19:309–352, 1988. [48] C. Harley y R. Reynolds. Analysis of e.coli promoter sequences. Nucleic Acids Research, 15(5):2343–2361, 1987. [49] J. Hern´ andez, M. Ram´ırez, y C. Ferri. Introducci´ on a la Miner´ıa de Datos. Pearson Prentice Hall, 2004. [50] G. Hertz y G. Stormo. Identifiying DNA and protein patterns with statistically significant alignments of multiple sequences. Bioinformatics, 15:563– 577, 1999. [51] Ingenuity Systems. http://www.ingenuity.com. [52] A Ishihama. Protein-protein communication within the transcription apparatus. J Bacteriol, 175:2483–2489, 1993. [53] P. Jaccard. The distribution of flora in the alpine zone. The New Phytologist, 11(2):37–50, 1912. [54] I. Jonyer, D. J. Cook, y L. B. Holder. Discovery and evaluation of graphbased hierarchical conceptual clusters. Journal of Machine Learning Research, 2:19–43, 2001. [55] C. Kanz, P. Aldebert, N. Althorpe, W. Baker, A. Baldwin, K. Bates, P. Browne, A. van den Broek, M. Castro, G. Cochrane, K. Duggan, R. Eberhardt, N. Faruque, J. Gamble, F. Garc´ıa-Diez, N. Harte, T. Kuli˜ kova, Q. Lin, V. Lombard, R. Lopez, R. Mancuso, M. McHale, F. Nardone, V. Silventoinen, S. Sobhany, P. Stoehr, M. Tuli, K. Tzouvara, R. Vaughan, D. Wu, W. Zhu, y R. Apweiler. The EMBL Nucleotide Sequence Database. Nucleics Acids Research, 33(suppl 1):D29–33, 2005. [56] G. Klir y T. Folger. Fuzzy sets, uncertainty, and information. PrenticeHall, Inc., 1987.

174

BIBLIOGRAF´IA

[57] W. Kl¨ osgen. Explora: A multipattern and multistrategy discovery assistant. En Advances in Knowledge Discovery and Data Mining, p´ aginas 249–271. MIT Press, 1996. [58] R. Kohavi y G.H. John. Wrappers for feature subset selection. Artificial Intelligence, 97:273–324, 1997. [59] J. Koza. Genetic Programming: On the Programming of Computers by Means of Natural Selection. MIT Press, Cambridge, MA, USA, 1992. [60] F. Kursawe. A variant of evolution strategies for vector optimization. En PPSN I: Proceedings of the 1st Workshop on Parallel Problem Solving from Nature, p´ aginas 193–197, London, UK, 1991. Springer-Verlag. [61] W. Langdon. Genetic Programming + Data Structures = Automatic Programming! Engineering and Computer Science. Kluwer, 1998. [62] S. Lee y H. Wang. Modified simulated annealing for multiple objective engineering design optimization. Journal of Intelligent Manufacturing, 3:101–108, 1992. [63] B. Lewin. Genes VII. Marb´ an, 2001. [64] B. Masand. Advances in Genetic Programming, cap´ıtulo Optimising confidence of text classification by evolution of symbolic expressions, p´ aginas 445–458. MIT Press, 1994. [65] Z. Michalewicz y D.B. Fogel. How to solve it: modern heuristics. SpringerVerlag New York, Inc., New York, NY, USA, 2000. [66] T. Mitchell. Machine Learning. McGraw-Hill, New York, 1997. [67] P. Moscato. On evolution, search, optimization, genetic algorithms and martial arts: Towards memetic algorithms. Technical Report C3P Report 826, Caltech Concurrent Computation Program, 1989. [68] I. Osman. An introduction to meta-heuristics. Operational Research Tutorial Papers Series, Annal Conference OR37 - Canterbury, 1995. [69] A. Osyczka. An approach to multicriterion optimization problems for engineering design. Computer Methods in Applied Mechanics and Engineering, 15:309–333, 1978. [70] Pathway Assit. http://www.ariadnegenomics.com/products/pathway.html. [71] J. Pearl. Heuristics: Intelligent Search Strategies for Computer Problem Solving. Addison-Wesley, 1984.

BIBLIOGRAF´IA

175

[72] W. Pedrycz, P. Bonissone, y E. Ruspini. Handbook of fuzzy computation. Institute of Physics, 1998. [73] Y. Pilpel, P. Sudarsanam, y G.M. Church. Identifying rgulatory networks by combinatorial analysis of promoter elements. Nature Genet., 29:153– 159, 2001. [74] K. Robison, A.M. McGuire, y G.M. Church. A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome. J Mol Biol, 284(2):241–54, 1998. [75] K. Rodriguez-Vazquez, C. Fonseca, y P. Fleming. Multiobjective genetic programming: A nonlinear system identification application. En J. Koza, editor, Late Breaking Papers at the 1997 Genetic Programming Conference, p´ aginas 207–212, Stanford University, CA, USA, 13–16 Julio 1997. [76] R. Romero-Zaliz, O. Cord´ on, C. Rubio-Escudero, I. Zwir, y J.P. Cobb. A multi-objective evolutionary conceptual clustering methodology for gene annotation from networking databases. Sometido. [77] R. Romero-Zaliz, I. Zwir, y F. Herrera. B´ usqueda dispersa multiobjetivo de promotores en secuencias de ADN. En MAEB’04 (Tercer congreso espa˜ nol de Metaheur´ısticas, Algoritmos Evolutivos y Bioinspirados), p´ aginas 141–147, C´ ordoba, Espa˜ na, Febrero 2004. [78] R. Romero-Zaliz, I. Zwir, y E. Ruspini. Applications of Multi-Objective Evolutionary Algorithms, cap´ıtulo Generalized Analysis of Promoters (GAP): A method for DNA sequence description, p´ aginas 427–450. World Scientific, 2004. [79] C. Rubio-Escudero, R. Romero-Zaliz, O. Cord´ on, J.P. Cobb, y I.Zwir. Identifying gene profiles by reverse problem solving: from grouping gene expressions to combining microarray analysis methods, 2005. Sometido. [80] E. Ruspini. A new approach to clustering. Information and Control, 15(1):22–32, 1969. [81] E. Ruspini. Recent developments in fuzzy clustering. En R. Yager, editor, Fuzzy Sets and Possibility Theory, Recent Developments, p´ aginas 133–147. Pergamon Press, 1982. [82] E. Ruspini y I. Zwir. Automated generation of qualitative representations of complex object by hybrid soft-computing methods. En S. Pal y A. Pal, editores, Pattern Recognition: From Classical to Modern Approaches, p´ aginas 453–474, Singapore, 2001. World Scientific Company.

176

BIBLIOGRAF´IA

[83] Wrobel S. Inductive logic programming for knowedge discovery in databases, p´ aginas 74–99. Springer-Verlag New York, Inc., New York, NY, USA, 2000. [84] H. Salgado, A. Santos-Zavaleta, S. Gama-Castro, D. Mill´ an-Z´ arate, E. D´ıaz-Peredo, F. S´ anchez-Solano, E. P´erez-Rueda, C. BonavidesMart´ınez, y J. Collado-Vides. RegulonDB (version 3.2): transcriptional regulation and operon organisation in escherichia coli k-12. Nucleic Acids Research, 29:72–74, 2001. [85] J. Setubal y J. Meidanis. Introduction to computational molecular biology. PWS Publishing Company, 1997. [86] N. Srinivas y K. Deb. Multiobjective optimization using nondominated sorting in genetic algorithms. Evolutionary Computation, 2(3):221–248, 1994. [87] S. Tavazoie, J. Hughes, M. Campbell, R. Cho, y G. Church. Systematic determination of genetic network architecture. Nature Genet., 22(3):281– 285, 1999. [88] A. Ulyanov y G. Stormo. Multi-alphabet consensus algorithm for identification of low specificity protein-DNA interactions. Nucleic Acids Research, 23(8):1434–1440, 1995. [89] M.D. Winfield y E.A. Groisman. Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes. Proc Natl Acad Sci U S A, 101:17162–17167, 2004. [90] M. Wong y K. Leung. Data Mining Using Grammar-Based Genetic Programming and Applications. Kluwer Academic Publishers, Norwell, MA, USA, 2000. [91] K.Y. Yeung y W.L. Ruzzo. Principal component analysis for clustering gene expression data. Bioinformatics, 17:763–774, 2001. [92] L.A. Zadeh. Fuzzy sets. Information Control, 8:338–353, 1965. [93] L.A. Zadeh. The concept of a linguistic variable and its application to approximate reasoning. Information Sciences, 8:119–249, 1975. [94] L.A. Zadeh. Knowledge representation in fuzzy logic. En R.R. Yager y L.A. Zadeh, editores, An Introduction to Fuzzy Logic Applications in Intelligent Systems, p´ aginas 1–25. Kluwer, Boston, 1992. [95] R. Romero Zaliz, O. Cord´ on, C. Rubio, y I. Zwir. A multiobjective evolutionary fuzzy system for promoter discovery in e. coli. En I International Workshop on Genetic Fuzzy Systems, p´ aginas 68–75, Granada, Espa˜ na, Marzo 2005.

BIBLIOGRAF´IA

177

[96] E. Zitzler. Evolutionary Algorithms for Multiobjective Optimization: Methods and Applications. PhD thesis, Swiss Federal Institute of Technology (ETH), Zurich, Switzerland, Noviembre 1999. [97] E. Zitzler, K. Deb, y L. Thiele. Comparison of multiobjective evolutionary algorithms: Empirical results. Evolutionary Computation, 8(2):173–195, 2000. [98] E. Zitzler y L. Thiele. Multiobjective evolutionary algorithms: A comparative case study and the Strength Pareto Approach. IEEE Transactions on Evolutionary Computation, 3(4):257–271, Noviembre 1999. [99] I. Zwir, R. Romero-Zaliz, H. Huang, y E.A. Groisman. Extracting promoter features from genomic datasets: towards an annotation of genome regulatory regions. Sometido. ˜ [100] I. Zwir, D. Shin, A. Kato, K.Nishino, T. Latifi, F. Solomon, J.M. Hare, H. Huang, y E.A. Groisman. Dissecting the Phop regulatory network of Escherichia coli and Salmonella enterica. PNAS, 102(8):2862–2867, 2005.

178

BIBLIOGRAF´IA

Glosario

ADN polimerasa enzima que sintetiza una cadena hija (o varias) de ADN (bajo la direcci´ on de una plantilla o molde de ADN). Puede participar en la reparaci´ on o en la replicaci´ on. ADNc ADN de cadena sencilla complementario de un ARN, sintetizado a partir de ´el por transcripci´ on inversa in vitro. ARN polimerasa enzima que sintetiza ARN utilizando un molde de ADN. Citoplasma descriptor del material entre la membrana plasm´ atica y el n´ ucleo. Cod´ on triplete de nucle´ otidos que representa un amino´ acido o una se˜ nal de terminaci´ on. Cod´ on de terminaci´ on una de las tres secuencias de tripletes, UAG, UAA, o UGA, que dan lugar a la terminaci´ on de la s´ıntesis prote´ınica. Se llaman tambi´en codones “sin sentido”. Corriente abajo identifica secuencias que van m´ as all´ a en la direcci´ on de la expresi´ on. Por ejemplo, la regi´ on codificadora est´ a corriente abajo del cod´ on de iniciaci´ on. Se llama tambi´en r´ıo abajo (downstream) 179

BIBLIOGRAF´IA

180 Corriente arriba

identifica secuencias que se mueven en la direcci´ on opuesta de la expresi´ on. Por ejemplo, el promotor bacteriano est´ a corriente arriba de la unidad de transcripci´ on, y el cod´ on de iniciaci´ on est´ a corriente arriba de la regi´ on de codificaci´ on. Se llama tambi´en r´ıo arriba (upstream). Cromosoma unidad discreta del genoma que transporta muchos genes. Cada cromosoma consiste en una mol´ecula muy larga de ADN d´ uplex y una masa aproximadamente igual de prote´ınas. Solo es visible como entidad morfol´ ogica durante la divisi´ on celular. Deleciones cambios generados por la eliminaci´ on de una secuencia de ADN, uni´endose las regiones que exist´ıan a cada lado. Dominio (de una prote´ına) porci´ on de una prote´ına que tiene una estructura terciaria por s´ı misma. Las prote´ınas m´ as grandes est´ an formadas por varios dominios, cada uno de los cuales est´ a conectado al siguiente a trav´es de regiones de la cadena polipept´ıdica cortas y flexibles. Enzimas de restricci´ on las que reconocen secuencias cortas espec´ıficas del ADN y rompen el d´ uplex (a veces en un sitio de binding, a veces en otro, dependiendo del tipo). Estructura cuaternaria (de una prote´ına) constituci´ on multim´erica de la prote´ına. Estructura terciaria (de una prote´ına) organizaci´ on en el espacio de la cadena polipept´ıdica de la prote´ına. Ex´ on cualquier segmento de un gen interrumpido que est´ a representado en el producto del ARN maduro. Factor sigma subunidad de la ARN polimerasa bacteriana necesaria para la iniciaci´ on. Es el principal determinante para la selecci´ on de los sitios de uni´ on (promotores).

Glosario

181

Footprinting t´ecnica para identificar el sitio del ADN donde se une alguna prote´ına en virtud de la protecci´ on de las uniones de esta regi´ on contra el ataque por nucleasas. Gen segmento de ADN involucrado en producir una cadena polipept´ıdica. Comprende regiones que preceden y siguen a la regi´ on codificadora as´ı como secuencias intermedias (intrones) entre segmentos codificadores individuales (exones). Gen regulador gen que codifica un ARN o un producto prote´ınico cuya funci´ on es controlar la expresi´ on de otros genes. Genes estructurales genes que codifican cualquier ARN o producto prote´ınico que no sea un regulador. Hibridaci´ on emparejamiento de cadenas complementarias de ADN y ARN para dar lugar a un h´ıbrido ADN-ARN. Inserciones se identifican por la presencia de un tramo adicional de pares de bases en el ADN. Intr´ on segmento de ADN que se transcribe, pero que es eliminado del interior de la transcripci´ on por un empalme entre las secuencias de los exones situados a cada lado del mismo. Marco de lectura abierto (ORF) el que contiene una seria de tripletes que codifican amino´ acidos sin codones de terminaci´ on de ninguna clase. La secuencia es (potencialmente) traducible a prote´ınas. Mutaci´ on cualquier cambio en la secuencia del ADN del genoma.

BIBLIOGRAF´IA

182 Oper´ on

una unidad de la expresi´ on y regulaci´ on gen´etica bacteriana, incluyendo genes estructurales y elementos de control en el ADN reconocidos por el producto de un gen regulador. Operador sitio del ADN donde una prote´ına represora se une para impedir que se inicie la transcripci´ on en el promotor adyacente. Par de bases (pb) emparejamiento de A con T o de C con G en una doble h´elice de ADN. Se pueden formar otros pares en el ARN bajo determinadas circunstancias. Promotor regi´ on del ADN que participa en la uni´ on de la ARN polimerasa para iniciar la transcripci´ on. Regi´ on -10 secuencia consenso centrada unos 10 pb antes del punto de comienzo de un gen bacteriano. Participa en la uni´ on inicial de la ARN polimerasa al ADN. Regi´ on -35 secuencia consenso centrada unos 35 pb antes del punto de comienzo de un gen bacteriano. Participa en la uni´ on inicial de la ARN polimerasa al ADN. Secuencia consenso secuencia idealizada en la que cada posici´ on representa la base que se encuentra con mayor frecuencia cuando se comparan muchas secuencias reales. Sito activo parte restringida de una prote´ına donde se une un sustrato. Terminador secuencia de ADN, representada al final de la transcripci´ on, que hace que la ARN polimerasa termine la transcripci´ on. Transcripci´ on s´ıntesis del ARN sobre un molde de ADN.

Glosario

183

Vector de clonaci´ on pl´ asmido o fago que se utiliza para “transportar” ADN extra˜ no insertado con el fin de producir m´ as materia o un producto prote´ınico.

´Indice alfab´etico

a´cido desoxirribonucleico (ADN), 7 ribonucleico (ARN), 9 algoritmo APRIORI, 37, 115, 140 de ajuste, 106 evolutivo, 40 gen´etico, 40 mem´etico, 107 multiobjetivo, 52 SUBDUE, 37, 115, 140 alineamiento, 21

nucle´ otido, 8 organismo eucariota, 13, 127 procariota, 13, 91 patr´ on reconocimiento, 20 regi´ on -10, 96, 103 regi´ on -35, 96, 103 programaci´ on gen´etica, 49 promotor, 20, 103 prote´ına, 9 plegamiento, 22

bioinform´ atica, 18 regi´ on promotora, 13 c´elula, 7 clustering, 31 conceptual, 34 cod´ on, 11

selecci´ on, 14 sitio de binding, 20

difuso conjunto, 28, 105 l´ ogica, 28 gen, 12, 20, 21 ontolog´ıa, 130 phoP, 91, 99 regulaci´ on, 22 microarray, 17, 102 mutaci´ on, 14 184

Loading...

Universidad de Granada - Decsai

Universidad de Granada Departamento de Ciencias de la Computacio´n e Inteligencia Artificial ‘‘Reconocimiento de Perfiles de Regulacio´n Gen´etica M...

7MB Sizes 3 Downloads 16 Views

Recommend Documents

Universidad de Granada - Decsai
Nuestra hipótesis de partida es que varios de los problemas clásicos de las plataformas e-learning, mencionados a ......

PGPR - Universidad de Granada
como estrategia para incrementar la disponibilidad de P y la eficiencia del uso del agua en la revegetación de .... PEG

exosomas - Universidad de Granada
enzimáticas de CD38 así como su función en fisiología y patología. Muchos años de investigación han ... cADPR, dado su i

Universidad de Granada
el planteamiento de la investigación como las conclusiones se presentan en dos idiomas, español e inglés en nuestro ...

UNIVERSIDAD DE GRANADA
técnicas de deformación de volúmenes médicos con la inten- ción de mejorar la exploración de los ... proponen una

Untitled - Universidad de Granada
Nov 13, 2015 - enfermedad y mortalidad, ni en los datos hematológicos ni de bioquímica sanguínea. En cambio, se obser

UNIVERSIDAD DE GRANADA
fertilidad y del microclima del suelo es objeto de estudio en el Capítulo 3. Concretamente, se ... temporales (horaria y

UNIVERSIDAD DE GRANADA
Que el trabajo que se presenta en esta Tesis Doctoral, con el título: “DESARROLLO DE NUEVAS METODOLOGÍAS PARA ANÁLI

tesis doctoral - Universidad de Granada
CHAPTER 2: ONLINE DISCLOSURE OF CORPORATE SOCIAL RESPONSIBILITY INFORMATION IN LEADING ...... actividad política (Steure

1.- Inicio - Universidad de Granada
Programa de doctorado distinguido con Mención hacia la Excelencia por el Ministerio de Educación. Garantizamos al firm